Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010393 [exp] 71 / 2e-16 ND / Lus10030114 [exp] 65 / 7e-15 ND / Lus10019563 [exp] 45 / 1e-06 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10020451 pacid=23139617 polypeptide=Lus10020451 locus=Lus10020451.g ID=Lus10020451.BGIv1.0 annot-version=v1.0 ATGACTCTTGAAAGCTACGCAGCTGCTCTGGTGATCACCCATGTGGCCAAAGGGTGGTGGAAATGGGGACCTTTAGAAGAATCTTCCTTGGATGTCAGGA TTGGAAGTACGGTTGTGGGTGTTTGTATTGAGCTTGGGTATTCTTGGAAGATGGGAGCGTGGTGGACGAAGATGTCATTCACACCAGAACGAAAAGGTGC AACCACGTTGACTTGTACAAGAAGATTGAAATGTGGAAGGATTCGTTTTGGACGATGA
AA sequence Show only first row Show all	>Lus10020451 pacid=23139617 polypeptide=Lus10020451 locus=Lus10020451.g ID=Lus10020451.BGIv1.0 annot-version=v1.0 MTLESYAAALVITHVAKGWWKWGPLEESSLDVRIGSTVVGVCIELGYSWKMGAWWTKMSFTPERKGATTLTCTRRLKCGRIRFGR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10020451 [exp]	0	1
AT4G13230			Late embryogenesis abundant pr...		Lus10011889 [exp]	2.2	0.9912
					Lus10021851 [exp]	2.6	0.9919
AT1G02520		MDR8, ABCB11, P...	multi-drug resistance 8, ATP-b...		Lus10004530 [exp]	3.7	0.9919
AT4G01310			Ribosomal L5P family protein (...		Lus10036391 [exp]	4.0	0.9842
AT1G16760			Protein kinase protein with ad...		Lus10033340 [exp]	4.0	0.9474
					Lus10008791 [exp]	4.6	0.9919
AT5G44440			FAD-binding Berberine family p...		Lus10010643 [exp]	4.7	0.9738
					Lus10012440 [exp]	5.3	0.9919
					Lus10026713 [exp]	5.5	0.9853
AT5G58380		PKS2, CIPK10, S...	SNF1-RELATED PROTEIN KINASE 3....		Lus10030546 [exp]	6.5	0.9847

Compare expression of checked genes

Lus10020451 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.