Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G33640 133 / 4e-42 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007087 [exp] 162 / 2e-53 AT4G33640 134 / 2e-42 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G116400 [exp] 135 / 9e-43 AT4G33640 132 / 9e-42 unknown protein Potri.017G042432 [exp] 96 / 3e-27 AT4G33640 112 / 8e-34 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10020463 pacid=23139579 polypeptide=Lus10020463 locus=Lus10020463.g ID=Lus10020463.BGIv1.0 annot-version=v1.0 ATGAATGTAGCAGAAGAGGTGGAGCGCCTTAAAGAAGAGATCCACAGACTCGGCACCACCACCCCCGATGGTTCCTTCAAGGTGACGTTTGGAGTGTTGT TCCATGACGAAAGGTGCGCCAACATCTTCGAAGCGTTAGTGGGAACACTGAGGGCAGCAAAGAAGAGGAAAATAGTAGCCTACGATGGGGAGCTGCTTCT TCAAGGAGTTCATGACAATGTAGAGATCACTCTTCTCCAACCTCCTACTACTACTCCCTCCGCCGATGCGACCACTTCCCCCGCCGCAGTTTGA
AA sequence Show only first row Show all	>Lus10020463 pacid=23139579 polypeptide=Lus10020463 locus=Lus10020463.g ID=Lus10020463.BGIv1.0 annot-version=v1.0 MNVAEEVERLKEEIHRLGTTTPDGSFKVTFGVLFHDERCANIFEALVGTLRAAKKRKIVAYDGELLLQGVHDNVEITLLQPPTTTPSADATTSPAAV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G33640			unknown protein		Lus10020463 [exp]	0	1
AT4G33640			unknown protein		Lus10007087 [exp]	2.8	0.8946
AT3G61260			Remorin family protein (.1)		Lus10018840 [exp]	4.9	0.8327
					Lus10026314 [exp]	5.5	0.8484
AT4G02580			NADH-ubiquinone oxidoreductase...		Lus10024851 [exp]	7.0	0.8281
AT3G53950			glyoxal oxidase-related protei...		Lus10024342 [exp]	7.1	0.8364
AT1G68330			unknown protein		Lus10034341 [exp]	7.9	0.8250
AT3G57400			unknown protein		Lus10018074 [exp]	8.2	0.8045
AT1G05850		CTL1, HOT2, ERH...	POM-POM1, SENSITIVE TO HOT TEM...		Lus10037430 [exp]	8.7	0.8430
AT1G12310			Calcium-binding EF-hand family...		Lus10004332 [exp]	9.2	0.8426
AT3G05545			RING/U-box superfamily protein...		Lus10029886 [exp]	11.0	0.7967

Compare expression of checked genes

Lus10020463 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.