Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G10550 48 / 2e-07 GTE2 global transcription factor group E2 (.1) AT5G65630 45 / 2e-06 GTE7 global transcription factor group E7 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007096 [exp] 151 / 3e-44 AT1G06230 213 / 1e-62 global transcription factor group E4 (.1.2.3) Lus10034067 [exp] 149 / 1e-43 AT1G06230 304 / 7e-95 global transcription factor group E4 (.1.2.3) Lus10010525 [exp] 119 / 2e-34 AT5G65630 188 / 7e-56 global transcription factor group E7 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G285700 [exp] 93 / 3e-23 AT1G73150 214 / 4e-63 global transcription factor group E3 (.1) Potri.009G080000 [exp] 91 / 2e-22 AT5G65630 180 / 1e-49 global transcription factor group E7 (.1) Potri.012G094300 [exp] 40 / 7e-05 AT5G63320 513 / 9e-168 nuclear protein X1 (.1.2.3) Potri.015G091800 [exp] 40 / 7e-05 AT5G63320 521 / 6e-171 nuclear protein X1 (.1.2.3) Potri.001G335000 [exp] 38 / 0.0005 AT3G27260 460 / 5e-151 global transcription factor group E8 (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10020471 pacid=23139535 polypeptide=Lus10020471 locus=Lus10020471.g ID=Lus10020471.BGIv1.0 annot-version=v1.0 ATGGTAAGCAAGCTTAGGCGTCAAGCACTGATTCTCCCTAACATTGTGGGAACTGAAGGCAACAAGGATGTTCCTGCTAGTGAGAGAATTGATGTTGTAA CCGAGTTGAAGAAGCCGAAGAAAGGAGGTGATGCCGGGGAAGAAGATGTGGACATTGGCGATGAAATGCCGATGAGCAGCTTTCCGCCAGTGGAGATCGA GAAGGACAACAACAATGGTGGTCATGCGAGTAGCAGTTCTAGCAGCTCGAGTAGTTCCAGTGATGATTCATCTTCATCCAGTGATTCTGACTCAGGAAGC TCTTCTGGGAGTGATTCGGAGGATGCTCATTCGTAG
AA sequence Show only first row Show all	>Lus10020471 pacid=23139535 polypeptide=Lus10020471 locus=Lus10020471.g ID=Lus10020471.BGIv1.0 annot-version=v1.0 MVSKLRRQALILPNIVGTEGNKDVPASERIDVVTELKKPKKGGDAGEEDVDIGDEMPMSSFPPVEIEKDNNNGGHASSSSSSSSSSSDDSSSSSDSDSGS SSGSDSEDAHS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G10550		GTE2	global transcription factor gr...		Lus10020471 [exp]	0	1
AT3G59380		FTA, PLP, ATFTA...	PLURIPETALA, farnesyltransfera...		Lus10015954 [exp]	2.6	0.8295
AT3G62790			NADH-ubiquinone oxidoreductase...		Lus10035034 [exp]	5.7	0.8191
AT3G58840		PMD1	peroxisomal and mitochondrial ...		Lus10007347 [exp]	8.2	0.8219
AT1G75390	bZIP	ATBZIP44	basic leucine-zipper 44 (.1.2)		Lus10024279 [exp]	10.2	0.7879
AT1G80760		NLM7, NIP6;1	NOD26-like intrinsic protein 6...		Lus10024066 [exp]	10.5	0.7738
AT3G16190			Isochorismatase family protein...		Lus10006833 [exp]	10.9	0.8048
AT5G03440			unknown protein		Lus10026537 [exp]	11.4	0.7551
AT3G59280		TXR1	THAXTOMIN A RESISTANT 1, Prote...		Lus10043207 [exp]	13.4	0.8075
AT1G26355		SP1L1	SPIRAL1-like1 (.1)		Lus10036916 [exp]	14.1	0.7710
AT3G18410			Complex I subunit NDUFS6 (.1.2...		Lus10009665 [exp]	16.0	0.8103

Compare expression of checked genes

Lus10020471 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.