Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10026110 [exp] 66 / 2e-13 AT1G79650 519 / 0.0 RADIATION SENSITIVE23B, Arabidopsis thaliana aldehyde oxidase 1, Rad23 UV excision repair protein family (.1.2.3.4)
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10020933 pacid=23177978 polypeptide=Lus10020933 locus=Lus10020933.g ID=Lus10020933.BGIv1.0 annot-version=v1.0 ATGATTCGAGCAGCAGAGGAGTTGTTGCTCATCAGTCATCACCATTCAGAGATGCTTGTATGTAGGTGTCCATTAGCTTTGCTGGTGATGTATCCCTCTC CTGTTGTCAAGTTTTCTATGGAGTTTGTGGTTTTCATCGTTGAGGACATCTACTCCTTGCGTGATGCGCGACGTCATCCTTACGAGTGTGTAATGTTCGT TATCGCAAGCCAGAAATCCCAGCAATCATCCTTACGAGTGTGTAATGTTCGTTATCGCAAGCAAGAAATCGCAGCAATCAATCTTCGAAATCTCCAGCAT GCTCCAGAAGGTAATTCGCCGCCAATTCCTCGTTCCCATCGCAAGCCAGAAATACTTCAATCACTAGAGGTCCATCGAATCCCATGA
AA sequence Show only first row Show all	>Lus10020933 pacid=23177978 polypeptide=Lus10020933 locus=Lus10020933.g ID=Lus10020933.BGIv1.0 annot-version=v1.0 MIRAAEELLLISHHHSEMLVCRCPLALLVMYPSPVVKFSMEFVVFIVEDIYSLRDARRHPYECVMFVIASQKSQQSSLRVCNVRYRKQEIAAINLRNLQH APEGNSPPIPRSHRKPEILQSLEVHRIP

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10020933 [exp]	0	1
AT1G13810			Restriction endonuclease, type...		Lus10033589 [exp]	1.0	0.9309
AT5G38260			Protein kinase superfamily pro...		Lus10025492 [exp]	9.2	0.7514
AT2G37550		ASP1, AGD7	yeast pde1 suppressor 1, ARF-G...		Lus10036211 [exp]	15.1	0.7036
AT2G28180		CHX08, ATCHX8	CATION/H+ EXCHANGER 8, Cation...		Lus10021415 [exp]	16.6	0.8125
AT5G61280			Remorin family protein (.1)		Lus10034714 [exp]	17.1	0.7691
AT3G48300		CYP71A23	"cytochrome P450, family 71, s...		Lus10019157 [exp]	19.8	0.7192
AT1G04480			Ribosomal protein L14p/L23e fa...		Lus10008065 [exp]	22.8	0.7545
AT1G59950			NAD(P)-linked oxidoreductase s...		Lus10039266 [exp]	24.4	0.7697
AT4G26110		NAP1;1, ATNAP1;...	ARABIDOPSIS THALIANA NUCLEOSOM...		Lus10042106 [exp]	24.8	0.7855
AT4G05440		EDA35	embryo sac development arrest ...		Lus10000812 [exp]	25.3	0.7642

Compare expression of checked genes

Lus10020933 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.