Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10022600 [exp] 69 / 3e-17 ND / Lus10017210 [exp] 56 / 9e-12 ND / Lus10021100 [exp] 54 / 5e-11 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10021499 pacid=23179130 polypeptide=Lus10021499 locus=Lus10021499.g ID=Lus10021499.BGIv1.0 annot-version=v1.0 ATGGGAAACCTGAGGAACTCTATGCTTATTCTGCTTCTAATACTCGCTCTATCAGCCACCAACATCTCCAAATCTGCAGAAGCAAGAACACTTCCCTTCT CATCTCTTCACCTACGATCTTCCAAGATATTTGCAACACTGGGAGTCGAATGCAAGTGCTGTGACAGCGGAGGATGTTCAAGCTCCTGGAAAGGGTCTTG CAGCGATGTCAAGTGTCTTCCCTGGAGAATTGGGTAG
AA sequence Show only first row Show all	>Lus10021499 pacid=23179130 polypeptide=Lus10021499 locus=Lus10021499.g ID=Lus10021499.BGIv1.0 annot-version=v1.0 MGNLRNSMLILLLILALSATNISKSAEARTLPFSSLHLRSSKIFATLGVECKCCDSGGCSSSWKGSCSDVKCLPWRIG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10021499 [exp]	0	1
					Lus10022600 [exp]	1.0	0.9401
AT2G35795			Chaperone DnaJ-domain superfam...		Lus10041420 [exp]	2.8	0.8662
AT5G52060		ATBAG1	BCL-2-associated athanogene 1 ...		Lus10029598 [exp]	12.6	0.7442
AT1G04960			Protein of unknown function (D...		Lus10014626 [exp]	12.7	0.8344
AT4G37530			Peroxidase superfamily protein...		Lus10011079 [exp]	13.4	0.8364
AT1G68090		ANN5, ANNAT5	ANNEXIN ARABIDOPSIS THALIANA 5...		Lus10037992 [exp]	15.8	0.8433
AT3G26980		MUB4	membrane-anchored ubiquitin-fo...		Lus10035184 [exp]	17.0	0.8372
AT3G09010			Protein kinase superfamily pro...		Lus10011193 [exp]	21.2	0.8326
AT4G03230			S-locus lectin protein kinase ...		Lus10039725 [exp]	25.7	0.7724
AT3G56770	bHLH	bHLH107	basic helix-loop-helix (bHLH) ...		Lus10038306 [exp]	31.3	0.8346

Compare expression of checked genes

Lus10021499 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.