Lus10021599 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G62810 138 / 8e-44 complex 1 family protein / LVR family protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10040570 185 / 2e-62 AT3G62810 158 / 1e-51 complex 1 family protein / LVR family protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.014G129800 140 / 1e-44 AT3G62810 158 / 9e-52 complex 1 family protein / LVR family protein (.1)
PFAM info
Representative CDS sequence
>Lus10021599 pacid=23182102 polypeptide=Lus10021599 locus=Lus10021599.g ID=Lus10021599.BGIv1.0 annot-version=v1.0
ATGCTACGAACAGAAGCCTTAACTGCATACAAAGCTCTGCTAAGAGCTACTCGTAAATCATTTGCTGGTGACCAGATGATGTTGAATGCTTCAAGCATTG
AGATCAGGACGAAATTCGAAGAGAATCGTCTCGTGAACTCTGAGACCGAGATCAGAAGGCTCCTTGAAGAGGCACGTGAGGCATCTGATTTCATAGCAAC
CATGATTGTTCAAGCCAAGTTGAATGAACGGGGTGGCTATGAGATAAAAGCGAGTAAGGAACATGCTGATGCGACACTTGAGATTCCATCGGAGGAGCTT
CTTCGCAAGACCAGCTGA
AA sequence
>Lus10021599 pacid=23182102 polypeptide=Lus10021599 locus=Lus10021599.g ID=Lus10021599.BGIv1.0 annot-version=v1.0
MLRTEALTAYKALLRATRKSFAGDQMMLNASSIEIRTKFEENRLVNSETEIRRLLEEAREASDFIATMIVQAKLNERGGYEIKASKEHADATLEIPSEEL
LRKTS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT3G62810 complex 1 family protein / LVR... Lus10021599 0 1
AT2G44620 MTACP1, MTACP-1 mitochondrial acyl carrier pro... Lus10043348 2.0 0.8331
AT2G44620 MTACP1, MTACP-1 mitochondrial acyl carrier pro... Lus10019500 6.5 0.7912
AT1G26750 unknown protein Lus10016383 6.9 0.8000
AT1G29990 PFD6, PDF6 prefoldin 6 (.1) Lus10023313 8.6 0.8105
AT2G43780 unknown protein Lus10035718 9.2 0.7815
AT5G37475 Translation initiation factor ... Lus10008317 11.3 0.7697
AT2G38280 ATAMPD, FAC1 EMBRYONIC FACTOR1, ADENOSINE 5... Lus10005043 14.0 0.7572
AT2G37120 S1FA-like DNA-binding protein ... Lus10015073 15.9 0.7414
AT1G32210 ATDAD1 DEFENDER AGAINST APOPTOTIC DEA... Lus10010413 18.2 0.7631
AT5G62980 FOLB2 Dihydroneopterin aldolase (.1) Lus10021252 23.7 0.7912

Lus10021599 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.