Plant FIBer expression Database

Lus10021847 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G58005 149 / 4e-48 Cytochrome c oxidase, subunit Vib family protein (.1.2)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10036285
[exp]
220 / 3e-76 AT5G58005 146 / 7e-47 Cytochrome c oxidase, subunit Vib family protein (.1.2)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.018G109400
[exp]
150 / 2e-48 AT5G58005 174 / 1e-57 Cytochrome c oxidase, subunit Vib family protein (.1.2)
Potri.006G186500
[exp]
149 / 6e-48 AT5G58005 173 / 1e-57 Cytochrome c oxidase, subunit Vib family protein (.1.2)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0351 CHCH PF02297 COX6B Cytochrome oxidase c subunit VIb
Representative CDS sequence
>Lus10021847 pacid=23158088 polypeptide=Lus10021847 locus=Lus10021847.g ID=Lus10021847.BGIv1.0 annot-version=v1.0
ATGTCGGCGACGGAATCAAGAAACCCCGATCATGTTCACGCCGACGTGCTCTTGCAAGCCAGAGAAGCTTGCTACAAGGCTCGTGATACTTTCTACTCTT
GTCTAGAGAATCAATCGGGGAAGAAGCCGACGGAGAATGGATGCGTCGGGTTGCTTTACCCGATGGAGTGCAAAACCTCAAGGATTGATTACGAGAACAG
CTGCCGAGCTTCTTGGGTGAAGCATTTCGATAGGCTGTATTGTAAGGAGAAGAAGGTGCAGAGGCTATTGGATGACAAGGACACGAGGAGAGGTCCGTTG
GTACTTGCACAGCAACAAACCAATTAA
AA sequence
>Lus10021847 pacid=23158088 polypeptide=Lus10021847 locus=Lus10021847.g ID=Lus10021847.BGIv1.0 annot-version=v1.0
MSATESRNPDHVHADVLLQAREACYKARDTFYSCLENQSGKKPTENGCVGLLYPMECKTSRIDYENSCRASWVKHFDRLYCKEKKVQRLLDDKDTRRGPL
VLAQQQTN

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G58005 Cytochrome c oxidase, subunit ... Lus10021847
[exp]
0 1
AT3G18760 Translation elongation factor... Lus10038301
[exp]
3.7 0.8702
AT4G35980 unknown protein Lus10028436
[exp]
8.7 0.8649
AT5G59460 scarecrow-like transcription f... Lus10004969
[exp]
13.1 0.8503
AT5G18100 CSD3 copper/zinc superoxide dismuta... Lus10010651
[exp]
14.0 0.8462
AT2G37120 S1FA-like DNA-binding protein ... Lus10023177
[exp]
15.9 0.8139
AT5G09830 BolA-like family protein (.1) Lus10020861
[exp]
17.0 0.8372
AT1G29990 PFD6, PDF6 prefoldin 6 (.1) Lus10023313
[exp]
19.7 0.8230
AT2G04520 Nucleic acid-binding, OB-fold-... Lus10000920
[exp]
23.8 0.8372
AT3G61113 Ubiquitin related modifier 1 (... Lus10041378
[exp]
26.0 0.8528
AT4G00530 unknown protein Lus10037854
[exp]
26.8 0.8112

Lus10021847 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.