Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G62450 117 / 1e-36 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G071700 [exp] 119 / 2e-37 AT3G62450 110 / 6e-34 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10021958 pacid=23158042 polypeptide=Lus10021958 locus=Lus10021958.g ID=Lus10021958.BGIv1.0 annot-version=v1.0 ATGAAGTTTCTGGATTGGTACGCGAAGATAGCGGTGGGTTCTGCTCTAATCGGAGCTTCCATGGAGTTTTTCATGATCAAGACGGGCTTCTATGATAAGG TGACGGAACTGGAGTCGGAAAAACGCGCTTGGGAGAATTCACCTGAAGCTCAGGCAATGAGAGAGGCTTTGAATCCATGGAGAAACCATGACAAGCAAAC AGAAAACACTTCTTGA
AA sequence Show only first row Show all	>Lus10021958 pacid=23158042 polypeptide=Lus10021958 locus=Lus10021958.g ID=Lus10021958.BGIv1.0 annot-version=v1.0 MKFLDWYAKIAVGSALIGASMEFFMIKTGFYDKVTELESEKRAWENSPEAQAMREALNPWRNHDKQTENTS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G62450			unknown protein		Lus10021958 [exp]	0	1
AT2G23940			Protein of unknown function (D...		Lus10028450 [exp]	3.0	0.8876
AT5G09830			BolA-like family protein (.1)		Lus10020861 [exp]	4.5	0.8788
AT5G59460			scarecrow-like transcription f...		Lus10004969 [exp]	7.3	0.8713
AT5G59140			BTB/POZ domain-containing prot...		Lus10016485 [exp]	7.5	0.8585
AT2G02570			nucleic acid binding;RNA bindi...		Lus10024458 [exp]	10.7	0.8545
AT4G22380			Ribosomal protein L7Ae/L30e/S1...		Lus10025435 [exp]	11.4	0.8560
AT1G12390			Cornichon family protein (.1)		Lus10004320 [exp]	13.7	0.8396
AT1G51740		ATSYP81, SYP81,...	ORTHOLOG OF YEAST UFE1 \(UNKNO...		Lus10040237 [exp]	16.0	0.8347
AT1G76200			unknown protein		Lus10012279 [exp]	18.0	0.8443
AT4G28706			pfkB-like carbohydrate kinase ...		Lus10000210 [exp]	19.9	0.8059

Compare expression of checked genes

Lus10021958 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.