Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G69490 51 / 1e-08 NAC NAP, ANAC029, ATNAP Arabidopsis NAC domain containing protein 29, NAC-like, activated by AP3/PI (.1) AT1G61110 51 / 2e-08 NAC ANAC025 NAC domain containing protein 25 (.1) AT3G17730 50 / 2e-08 NAC ANAC057 NAC domain containing protein 57 (.1) AT5G17260 49 / 1e-07 NAC ANAC086 NAC domain containing protein 86 (.1) AT1G77450 48 / 2e-07 NAC ANAC032 NAC domain containing protein 32 (.1) AT2G18060 48 / 3e-07 NAC ANAC037, VND1 Arabidopsis NAC domain containing protein 37, vascular related NAC-domain protein 1 (.1) AT5G14000 47 / 4e-07 NAC ANAC084 NAC domain containing protein 84 (.1) AT5G13180 47 / 4e-07 NAC VNDIP2, ANAC083, VNI2 VND-interacting 2, NAC domain containing protein 83 (.1) AT1G54330 47 / 4e-07 NAC ANAC020 NAC domain containing protein 20 (.1) AT3G03200 47 / 5e-07 NAC ANAC045 NAC domain containing protein 45 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001876 [exp] 87 / 3e-21 AT1G01470 178 / 3e-54 LIGHT STRESS-REGULATED 3, LATE EMBRYOGENESIS ABUNDANT 14, Late embryogenesis abundant protein (.1) Lus10036117 [exp] 54 / 2e-09 AT3G15510 241 / 2e-78 NAC-REGULATED SEED MORPHOLOGY 1, Arabidopsis NAC domain containing protein 56, NAC domain containing protein 2 (.1) Lus10007410 [exp] 54 / 2e-09 AT3G15510 241 / 1e-78 NAC-REGULATED SEED MORPHOLOGY 1, Arabidopsis NAC domain containing protein 56, NAC domain containing protein 2 (.1) Lus10042284 [exp] 52 / 1e-08 AT3G17730 348 / 1e-121 NAC domain containing protein 57 (.1) Lus10043095 [exp] 51 / 2e-08 AT3G15510 351 / 1e-119 NAC-REGULATED SEED MORPHOLOGY 1, Arabidopsis NAC domain containing protein 56, NAC domain containing protein 2 (.1) Lus10026373 [exp] 51 / 2e-08 AT3G17730 348 / 2e-121 NAC domain containing protein 57 (.1) Lus10032657 [exp] 51 / 3e-08 AT3G15510 353 / 1e-120 NAC-REGULATED SEED MORPHOLOGY 1, Arabidopsis NAC domain containing protein 56, NAC domain containing protein 2 (.1) Lus10031951 [exp] 50 / 4e-08 AT3G04070 56 / 3e-09 NAC domain containing protein 47 (.1.2) Lus10011215 [exp] 50 / 5e-08 AT1G61110 305 / 1e-102 NAC domain containing protein 25 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G325100 [exp] 56 / 4e-10 AT5G13180 163 / 2e-49 VND-interacting 2, NAC domain containing protein 83 (.1) Potri.006G129400 [exp] 54 / 2e-09 AT1G61110 247 / 3e-80 NAC domain containing protein 25 (.1) Potri.015G030200 [exp] 51 / 1e-08 AT3G17730 374 / 6e-133 NAC domain containing protein 57 (.1) Potri.012G038100 [exp] 51 / 2e-08 AT3G17730 339 / 4e-118 NAC domain containing protein 57 (.1) Potri.004G038000 [exp] 50 / 2e-08 AT1G61110 332 / 3e-113 NAC domain containing protein 25 (.1) Potri.011G046700 [exp] 49 / 6e-08 AT1G61110 331 / 8e-113 NAC domain containing protein 25 (.1) Potri.010G166200 [exp] 49 / 7e-08 AT1G69490 305 / 1e-104 Arabidopsis NAC domain containing protein 29, NAC-like, activated by AP3/PI (.1) Potri.016G027900 [exp] 49 / 1e-07 AT2G24430 66 / 8e-12 Arabidopsis NAC domain containing protein 39, NAC domain containing protein 38 (.1.2) Potri.008G089000 [exp] 49 / 1e-07 AT1G69490 331 / 6e-115 Arabidopsis NAC domain containing protein 29, NAC-like, activated by AP3/PI (.1) Potri.011G123500 [exp] 48 / 2e-07 AT3G15510 323 / 4e-109 NAC-REGULATED SEED MORPHOLOGY 1, Arabidopsis NAC domain containing protein 56, NAC domain containing protein 2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02365 [flax] [poplar] NAM No apical meristem (NAM) protein
Representative CDS sequence Show only first row Show all	>Lus10022018 pacid=23160214 polypeptide=Lus10022018 locus=Lus10022018.g ID=Lus10022018.BGIv1.0 annot-version=v1.0 ATGGAATCAACCAAAGGTTATACATATCCGGTGGGTATTCGCTTTAATCCGAAGGAGGAAGAACTCGTCAATTATTACCTCAAGGGTAAAGCCAAAGGGG AGCCTCTGCCTTCGAACCTGATACATAAGATCGACCTCTACGGTGCTAAAACTCCTTGGGAGATCTTTCCTGGCAATAAAAGAATTAAGGATGCTAGGGA GAGACAAATTGGAATAAAGAAGACATTTAGTTTCAAAGTGACGAGTGAAAAAGCAAAGGTGAAAGGAAAGAGTTGTGCTTCTTCTTCTTCTACTGCTGTT GCTGAAGGTTCTTCTGGTTGGATTATGCACGAATATTCCCTATTAGGATAG
AA sequence Show only first row Show all	>Lus10022018 pacid=23160214 polypeptide=Lus10022018 locus=Lus10022018.g ID=Lus10022018.BGIv1.0 annot-version=v1.0 MESTKGYTYPVGIRFNPKEEELVNYYLKGKAKGEPLPSNLIHKIDLYGAKTPWEIFPGNKRIKDARERQIGIKKTFSFKVTSEKAKVKGKSCASSSSTAV AEGSSGWIMHEYSLLG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G69490	NAC	NAP, ANAC029, A...	Arabidopsis NAC domain contain...		Lus10022018 [exp]	0	1
					Lus10022017 [exp]	2.0	0.9446
AT2G44270		ROL5	repressor of lrx1 (.1.2)		Lus10009739 [exp]	4.2	0.9400
AT3G54480		SKP5, SKIP5	SKP1/ASK-interacting protein 5...		Lus10024168 [exp]	4.2	0.9402
AT5G43920			transducin family protein / WD...		Lus10011916 [exp]	5.3	0.9327
AT5G10860		CBSX3	CBS domain containing protein ...		Lus10019117 [exp]	6.5	0.9232
AT3G47160			RING/U-box superfamily protein...		Lus10001209 [exp]	6.5	0.9333
AT5G53220			unknown protein		Lus10001067 [exp]	6.6	0.9287
AT3G26850			histone-lysine N-methyltransfe...		Lus10002082 [exp]	7.1	0.9201
AT3G49640			Aldolase-type TIM barrel famil...		Lus10003486 [exp]	8.5	0.9400
AT5G11270		OCP3	overexpressor of cationic pero...		Lus10002899 [exp]	9.9	0.9083

Compare expression of checked genes

Lus10022018 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.