Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G40460 70 / 9e-17 unknown protein AT1G10690 59 / 2e-12 unknown protein AT1G60783 49 / 9e-09 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002514 [exp] 160 / 3e-52 AT5G40460 105 / 7e-31 unknown protein Lus10006204 [exp] 53 / 5e-10 AT1G60783 77 / 9e-20 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G070000 [exp] 110 / 7e-33 AT5G40460 89 / 3e-24 unknown protein Potri.010G045200 [exp] 69 / 3e-16 AT1G10690 92 / 2e-25 unknown protein Potri.008G187300 [exp] 53 / 3e-10 AT5G40460 97 / 3e-27 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10022268 pacid=23139451 polypeptide=Lus10022268 locus=Lus10022268.g ID=Lus10022268.BGIv1.0 annot-version=v1.0 ATGGCGGATTCCAGTCTAGAATCCGACGGGAAGAAATGGGTCATCGCTGGAATCTCAATAAAGTCACTGAAACCCATCAACACCAAACCCAGAGGCAGAG CAAGCGGTGGAGATAACACAGGGGAGGAAGAGGAGCGTTCAACTACGCCGACGGCGAAGGAGGCGAGAATACCGGAGAAACTGTCTTGCCCTCCAGCGCC GAGGAAGAGACGGCCGCCGCCGTCATCGTCAAGGTGCAACTACACGGTTGCTAGAGAGTTCTTCACTCCGCCTGACCTGGACACAGTCTTCAAACGCTAT GTTGAAAAAGCCAATTGA
AA sequence Show only first row Show all	>Lus10022268 pacid=23139451 polypeptide=Lus10022268 locus=Lus10022268.g ID=Lus10022268.BGIv1.0 annot-version=v1.0 MADSSLESDGKKWVIAGISIKSLKPINTKPRGRASGGDNTGEEEERSTTPTAKEARIPEKLSCPPAPRKRRPPPSSSRCNYTVAREFFTPPDLDTVFKRY VEKAN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G40460			unknown protein		Lus10022268 [exp]	0	1
AT5G27510			Protein kinase superfamily pro...		Lus10034285 [exp]	12.6	0.7008
AT5G65100	EIL		Ethylene insensitive 3 family ...		Lus10041709 [exp]	30.3	0.6487
AT1G75270		DHAR2	dehydroascorbate reductase 2 (...		Lus10040320 [exp]	32.5	0.7224
AT1G72570	AP2_ERF		Integrase-type DNA-binding sup...		Lus10037670 [exp]	35.6	0.7116
AT4G35190		LOG5	LONELY GUY 5, Putative lysine ...		Lus10025117 [exp]	51.4	0.6837
AT3G15460			Ribosomal RNA processing Brix ...		Lus10019857 [exp]	63.4	0.6922
AT5G50170			C2 calcium/lipid-binding and G...		Lus10037679 [exp]	64.9	0.6444
AT1G21740			Protein of unknown function (D...		Lus10042722 [exp]	98.8	0.6823
AT5G49180			Plant invertase/pectin methyle...		Lus10003968 [exp]	132.4	0.6146
AT2G29050		ATRBL1	RHOMBOID-like 1 (.1.2)		Lus10004965 [exp]	201.5	0.6396

Compare expression of checked genes

Lus10022268 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.