Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52770 62 / 1e-14 ZPR3 LITTLE ZIPPER 3, protein binding (.1) AT3G60890 37 / 0.0001 ZPR2 LITTLE ZIPPER 2, protein binding (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10014188 [exp] 77 / 3e-20 AT3G52770 72 / 1e-18 LITTLE ZIPPER 3, protein binding (.1) Lus10021375 [exp] 73 / 2e-18 AT3G52770 77 / 3e-20 LITTLE ZIPPER 3, protein binding (.1) Lus10017055 [exp] 72 / 3e-18 AT3G52770 77 / 5e-20 LITTLE ZIPPER 3, protein binding (.1) Lus10028902 [exp] 43 / 1e-06 AT3G60890 59 / 1e-12 LITTLE ZIPPER 2, protein binding (.1.2) Lus10008913 [exp] 42 / 3e-06 AT3G60890 58 / 2e-12 LITTLE ZIPPER 2, protein binding (.1.2) Lus10007017 [exp] 37 / 0.0003 AT3G60890 48 / 3e-08 LITTLE ZIPPER 2, protein binding (.1.2) Lus10006673 [exp] 36 / 0.0004 AT3G60890 47 / 4e-08 LITTLE ZIPPER 2, protein binding (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G083201 [exp] 75 / 2e-18 AT3G52770 54 / 2e-10 LITTLE ZIPPER 3, protein binding (.1) Potri.010G237600 [exp] 64 / 2e-15 AT3G52770 49 / 7e-10 LITTLE ZIPPER 3, protein binding (.1) Potri.008G021766 [exp] 62 / 8e-15 AT3G52770 51 / 1e-10 LITTLE ZIPPER 3, protein binding (.1) Potri.003G117200 [exp] 49 / 6e-09 AT3G60890 63 / 4e-14 LITTLE ZIPPER 2, protein binding (.1.2) Potri.014G071200 [exp] 45 / 1e-07 AT3G60890 62 / 1e-13 LITTLE ZIPPER 2, protein binding (.1.2) Potri.002G149600 [exp] 44 / 5e-07 AT3G60890 65 / 1e-14 LITTLE ZIPPER 2, protein binding (.1.2) Potri.001G114900 [exp] 44 / 6e-07 AT3G60890 57 / 1e-11 LITTLE ZIPPER 2, protein binding (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10022725 pacid=23178676 polypeptide=Lus10022725 locus=Lus10022725.g ID=Lus10022725.BGIv1.0 annot-version=v1.0 ATGGACAGTCTGAACTCAAAGCTCTACCTACAGAACTGCTACATAATGCAAGAGAACGAGAGGCTAAGGAAGAAAGCACAGCTTCTCAACCAGGAGAATC AAGCACTGATGTCTGAACTCAAACAGAAGCTCTCCAAGAAAGGAAACTCAAAATCCAAGTCTTCCAACTCAAACCATGACCAGAACTATGGATCAAGCTC TAACCAAAATCATGGCAACTCCAGCTGA
AA sequence Show only first row Show all	>Lus10022725 pacid=23178676 polypeptide=Lus10022725 locus=Lus10022725.g ID=Lus10022725.BGIv1.0 annot-version=v1.0 MDSLNSKLYLQNCYIMQENERLRKKAQLLNQENQALMSELKQKLSKKGNSKSKSSNSNHDQNYGSSSNQNHGNSS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G52770		ZPR3	LITTLE ZIPPER 3, protein bindi...		Lus10022725 [exp]	0	1
AT3G52770		ZPR3	LITTLE ZIPPER 3, protein bindi...		Lus10014188 [exp]	1.4	0.8313
AT1G10200	LIM	WLIM1, SF3	WLIM1, GATA type zinc finger t...		Lus10004230 [exp]	3.2	0.8064
AT4G14010		RALFL32	ralf-like 32 (.1)		Lus10008885 [exp]	4.9	0.7641
AT1G06980			unknown protein		Lus10025927 [exp]	5.7	0.8504
AT1G10200	LIM	WLIM1, SF3	WLIM1, GATA type zinc finger t...		Lus10042140 [exp]	11.7	0.7392
AT1G20823			RING/U-box superfamily protein...		Lus10015837 [exp]	17.3	0.6903
AT1G04360			RING/U-box superfamily protein...		Lus10000710 [exp]	18.2	0.7516
AT1G64940		CYP89A6	"cytochrome P450, family 87, s...		Lus10013067 [exp]	19.7	0.7817
AT4G13950		RALFL31	ralf-like 31 (.1)		Lus10016646 [exp]	21.9	0.7865
AT5G45340		CYP707A3	"cytochrome P450, family 707, ...		Lus10028594 [exp]	25.4	0.8029

Compare expression of checked genes

Lus10022725 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.