Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10009609 [exp] 64 / 3e-13 AT5G23060 466 / 3e-164 calcium sensing receptor (.1) Lus10016314 [exp] 60 / 8e-13 ND / Lus10000867 [exp] 63 / 9e-13 AT5G23060 466 / 2e-164 calcium sensing receptor (.1) Lus10030123 [exp] 52 / 3e-09 ND / Lus10012437 [exp] 49 / 8e-09 ND / Lus10025323 [exp] 47 / 4e-08 ND / Lus10003830 [exp] 47 / 7e-08 ND / Lus10008798 [exp] 44 / 8e-07 ND / Lus10021753 [exp] 45 / 1e-06 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10022950 pacid=23146187 polypeptide=Lus10022950 locus=Lus10022950.g ID=Lus10022950.BGIv1.0 annot-version=v1.0 ATGAGATCTACTATGAAGGAGAAGTTTGTTGAGTTGGAAGTGAGGAAGGATGCTGAGATGGTTGCTGCTTGTGCTGAATGGGTAGTTGAGAGAGAAGCCA TTAAGAGGTTCAAGGATAGTTACATAGAACGCTTGACTAGTCAGCTGAAAAATGCGAGATGGACGCTTCAGGTGGTGAGGGCTCGAGCTTCAAACGGAGT GGATGTGAAGAGGGTGACGAGGGATATGGTGGTTGAAGCTGGGAGTGAGAGAGAGGAGGAGATTGGTGGCGTTTTAGCTAGGTTTTGGTGGGTTTGGAGA AATGGAGCATAA
AA sequence Show only first row Show all	>Lus10022950 pacid=23146187 polypeptide=Lus10022950 locus=Lus10022950.g ID=Lus10022950.BGIv1.0 annot-version=v1.0 MRSTMKEKFVELEVRKDAEMVAACAEWVVEREAIKRFKDSYIERLTSQLKNARWTLQVVRARASNGVDVKRVTRDMVVEAGSEREEEIGGVLARFWWVWR NGA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10022950 [exp]	0	1
AT4G39950		CYP79B2	"cytochrome P450, family 79, s...		Lus10031726 [exp]	3.7	0.8424
					Lus10024863 [exp]	3.7	0.7643
AT1G65820			microsomal glutathione s-trans...		Lus10020792 [exp]	6.5	0.8340
AT1G75290			NAD(P)-binding Rossmann-fold s...		Lus10021709 [exp]	6.7	0.8331
AT1G07520	GRAS		GRAS family transcription fact...		Lus10037757 [exp]	8.7	0.8224
AT1G56260		MDO1	MERISTEM DISORGANIZATION 1, un...		Lus10029875 [exp]	14.3	0.6522
AT2G34790		MEE23, EDA28	MATERNAL EFFECT EMBRYO ARREST ...		Lus10023363 [exp]	17.6	0.7371
AT5G03050			unknown protein		Lus10012904 [exp]	22.8	0.6756
AT1G75980			Single hybrid motif superfamil...		Lus10017287 [exp]	25.2	0.7710
					Lus10029488 [exp]	28.2	0.6479

Compare expression of checked genes

Lus10022950 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.