Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G17350 134 / 8e-42 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10026564 [exp] 132 / 3e-41 AT2G17350 189 / 9e-64 unknown protein Lus10013847 [exp] 132 / 3e-41 AT2G17350 189 / 9e-64 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G169200 [exp] 134 / 5e-42 AT2G17350 144 / 8e-46 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10022984 pacid=23146164 polypeptide=Lus10022984 locus=Lus10022984.g ID=Lus10022984.BGIv1.0 annot-version=v1.0 ATGTCTTTGAGGATAAAAGTGGTGGTGAACAAATTCGTGGAGGAACTGAAAGAAGCACTGGACTCCGACATTCAAGAACGTATTATGAAGGAGAGGGAGA TGCAAAGCTACATCCAAGAGCGAGAACGAGAGGTCGCCGAGCGTGAAGCTGCCTGGAAGGCTGAGCTTTCTCGCCGCGAGGCAGAGATAGCAAAACAAGA AGCAAGGTTGAAGATGGAGAAAGAGAATCTGGAGAAAGAGAAAAGCATGCTGATGGGAACAGCATCGAATCAAGATGGTGCTCTTGAAATAACTGTGAGT GGTGAGAAGTACAGATGCCTCAGGTTCTCCAAGGCCAAGAAATGA
AA sequence Show only first row Show all	>Lus10022984 pacid=23146164 polypeptide=Lus10022984 locus=Lus10022984.g ID=Lus10022984.BGIv1.0 annot-version=v1.0 MSLRIKVVVNKFVEELKEALDSDIQERIMKEREMQSYIQEREREVAEREAAWKAELSRREAEIAKQEARLKMEKENLEKEKSMLMGTASNQDGALEITVS GEKYRCLRFSKAKK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G17350			unknown protein		Lus10022984 [exp]	0	1
AT2G48020			Major facilitator superfamily ...		Lus10008182 [exp]	1.4	0.8130
AT4G13200			unknown protein		Lus10022803 [exp]	2.0	0.8180
AT3G29280			unknown protein		Lus10018197 [exp]	2.4	0.8082
AT5G20700			Protein of unknown function (D...		Lus10022948 [exp]	7.7	0.7642
AT1G31812		ACBP6, ACBP	acyl-CoA-binding protein 6 (.1...		Lus10021246 [exp]	10.4	0.7635
AT5G64460			Phosphoglycerate mutase family...		Lus10020467 [exp]	17.5	0.7440
AT3G08890			Protein of unknown function, D...		Lus10022674 [exp]	19.4	0.7652
AT4G28240			Wound-responsive family protei...		Lus10018535 [exp]	21.8	0.7612
AT1G66980		GDPDL2, SNC4	Glycerophosphodiester phosphod...		Lus10022359 [exp]	22.1	0.7645
AT5G46030			unknown protein		Lus10015293 [exp]	22.3	0.7861

Compare expression of checked genes

Lus10022984 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.