Lus10023010 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10023010 pacid=23146107 polypeptide=Lus10023010 locus=Lus10023010.g ID=Lus10023010.BGIv1.0 annot-version=v1.0
ATGTCAAAAACAAAAACAAAACCAAACCGTTGGGTTGCGCTTAAATCCAATAGTACTAGGATAGTCATCGCAAGGGAAAACGTTGTGGCTGGTGACCAAA
ACAGACGGAGGAAAAATTCTGAAGCAGACGGAGGACCACAGAAAATTCCCTCCGATTCGCCGGCCAGAATGAAATCCTTAATTCCGTCAATTATCCGCTG
TCCAATTGCGAATTTAAAGATACCGTATTGCGATGGGAAGACGGAAGAAGTCAACCATTCATGGAGGAGAGGAGAGAAGGTCGGAGATGAGGCGAACAAG
ATTGAAGGAGAGAAAGAAGAGGAGAAGGAGATAGCAGAGGACGGCGGCGAAGCGGAAGAGGAGAAGGAAGAGGAAGAGAGCAACGACAATTGA
AA sequence
>Lus10023010 pacid=23146107 polypeptide=Lus10023010 locus=Lus10023010.g ID=Lus10023010.BGIv1.0 annot-version=v1.0
MSKTKTKPNRWVALKSNSTRIVIARENVVAGDQNRRRKNSEADGGPQKIPSDSPARMKSLIPSIIRCPIANLKIPYCDGKTEEVNHSWRRGEKVGDEANK
IEGEKEEEKEIAEDGGEAEEEKEEEESNDN

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10023010 0 1
Lus10007802 2.6 0.9301
AT2G45530 RING/U-box superfamily protein... Lus10033252 4.7 0.8992
AT2G44290 Bifunctional inhibitor/lipid-t... Lus10033076 4.9 0.9218
AT5G44120 ATCRA1, CRU1, C... CRUCIFERINA, RmlC-like cupins ... Lus10022929 5.0 0.9170
AT1G77410 BGAL16 beta-galactosidase 16 (.1) Lus10018138 5.3 0.9283
AT2G31730 bHLH basic helix-loop-helix (bHLH) ... Lus10024071 6.0 0.9067
AT2G45910 U-box domain-containing protei... Lus10017798 6.5 0.9160
AT3G28580 P-loop containing nucleoside t... Lus10014497 6.9 0.8987
AT5G62670 AHA11 H\(+\)-ATPase 11, H\(+\)-ATPas... Lus10028203 8.2 0.9177
AT1G12650 unknown protein Lus10005657 8.4 0.8554

Lus10023010 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.