Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G78410 54 / 3e-10 VQ motif-containing protein (.1) AT1G17147 50 / 3e-09 VQ motif-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038502 [exp] 173 / 2e-57 AT1G78410 48 / 4e-08 VQ motif-containing protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G095900 [exp] 73 / 7e-18 AT1G17147 64 / 1e-14 VQ motif-containing protein (.1) Potri.001G378300 [exp] 64 / 3e-14 AT1G17147 71 / 2e-17 VQ motif-containing protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05678 [flax] [poplar] VQ VQ motif
Representative CDS sequence Show only first row Show all	>Lus10023308 pacid=23181054 polypeptide=Lus10023308 locus=Lus10023308.g ID=Lus10023308.BGIv1.0 annot-version=v1.0 ATGGCGGCATCATCATCATCATCATCAAGCGTCAAGGTGGTGCTAATCAACACCCGGTACGTCGTGACCGAACCCGAGAGCTTCAAGTCCGTGGTCCAGA GACTCACCGGTAAGGACTCGTGCGTTTCCTGGATTGAAGAGGCGTCTTTCACCGGCGGCAAGAGGAAGAGGAAGCAGTCGATCTCGGAGTCTTCGGTCGG AGTTGACTCGACACGGGAGGCGAAAGTGGGGAGTGGGGAATGGAGGTTGTCGAAAGGGATGTCGTTCAAGGACTTGGATAGAATGATGATGGAGATTCCT ACGGGTGATGAGTTGCGTCAATTGTGGAGCATTGTATAA
AA sequence Show only first row Show all	>Lus10023308 pacid=23181054 polypeptide=Lus10023308 locus=Lus10023308.g ID=Lus10023308.BGIv1.0 annot-version=v1.0 MAASSSSSSSVKVVLINTRYVVTEPESFKSVVQRLTGKDSCVSWIEEASFTGGKRKRKQSISESSVGVDSTREAKVGSGEWRLSKGMSFKDLDRMMMEIP TGDELRQLWSIV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G78410			VQ motif-containing protein (....		Lus10023308 [exp]	0	1
					Lus10014739 [exp]	2.4	0.9650
					Lus10041164 [exp]	2.6	0.9781
AT5G39160			RmlC-like cupins superfamily p...		Lus10021980 [exp]	3.7	0.9762
AT3G23230	AP2_ERF	ERF98	Integrase-type DNA-binding sup...		Lus10011830 [exp]	6.3	0.9603
AT1G24020		MLP423	MLP-like protein 423 (.1.2)		Lus10039454 [exp]	6.6	0.9333
AT2G40740	WRKY	ATWRKY55, WRKY5...	WRKY DNA-binding protein 55 (....		Lus10034245 [exp]	7.3	0.9359
AT2G38870			Serine protease inhibitor, pot...		Lus10024870 [exp]	9.3	0.9213
					Lus10012132 [exp]	9.8	0.9197
AT3G61680			alpha/beta-Hydrolases superfam...		Lus10009811 [exp]	10.1	0.9379
AT5G53970		TAT7	tyrosine aminotransferase 7, T...		Lus10032654 [exp]	10.6	0.9379

Compare expression of checked genes

Lus10023308 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.