Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10023382 pacid=23181010 polypeptide=Lus10023382 locus=Lus10023382.g ID=Lus10023382.BGIv1.0 annot-version=v1.0 ATGGTGGAATTTCGCCAGCGGAGGAGCAATTCGGCACTGCTCGTTACACCAGCCAACCGAAGAGGCTACTCGGCCTTGCTTATCTCTGATTCATTTATCT TCTGCCGTGGAAAATACTCATCTGAAGAGTTGATAATTCAGGCTAGAACGGTACTGATTCTAATTGTTGAATAG
AA sequence Show only first row Show all	>Lus10023382 pacid=23181010 polypeptide=Lus10023382 locus=Lus10023382.g ID=Lus10023382.BGIv1.0 annot-version=v1.0 MVEFRQRRSNSALLVTPANRRGYSALLISDSFIFCRGKYSSEELIIQARTVLILIVE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10023382 [exp]	0	1
AT1G50430		ST7R, PA, LE, 7...	PARVA, LEPIDA, DWARF 5, DELTA5...		Lus10037309 [exp]	23.7	0.7642
AT2G44040			Dihydrodipicolinate reductase,...		Lus10024047 [exp]	71.4	0.7246
AT1G15860			Domain of unknown function (DU...		Lus10040019 [exp]	92.6	0.6893
AT5G41770			crooked neck protein, putative...		Lus10041477 [exp]	105.9	0.6974
AT5G55610			unknown protein		Lus10016608 [exp]	114.0	0.6935
AT5G05920		DHS, EDA22	embryo sac development arrest ...		Lus10042728 [exp]	143.7	0.6726
AT5G44230			Pentatricopeptide repeat (PPR)...		Lus10014279 [exp]	147.7	0.6783
AT5G54650		ATFH5, Fh5	FORMIN HOMOLOGY 5, formin homo...		Lus10018494 [exp]	237.9	0.6439
AT4G17910			transferases, transferring acy...		Lus10001270 [exp]	261.4	0.6350

Compare expression of checked genes

Lus10023382 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.