Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G34480 112 / 4e-33 Ribosomal protein L18ae/LX family protein (.1) AT3G14600 110 / 2e-32 Ribosomal protein L18ae/LX family protein (.1) AT1G29965 109 / 3e-32 Ribosomal protein L18ae/LX family protein (.1) AT1G29970 110 / 2e-31 RPL18AA 60S ribosomal protein L18A-1 (.1.2.3)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10023456 [exp] 120 / 2e-37 AT2G34480 147 / 1e-46 Ribosomal protein L18ae/LX family protein (.1) Lus10040332 [exp] 120 / 7e-37 AT2G34480 290 / 4e-102 Ribosomal protein L18ae/LX family protein (.1) Lus10019881 [exp] 121 / 1e-36 AT2G34480 337 / 4e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10023454 [exp] 121 / 1e-36 AT2G34480 337 / 4e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10023457 [exp] 121 / 1e-36 AT2G34480 337 / 2e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10014035 [exp] 122 / 3e-35 AT2G34480 338 / 2e-117 Ribosomal protein L18ae/LX family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G057600 [exp] 119 / 3e-36 AT2G34480 342 / 3e-122 Ribosomal protein L18ae/LX family protein (.1) Potri.011G072400 [exp] 115 / 1e-34 AT2G34480 349 / 4e-125 Ribosomal protein L18ae/LX family protein (.1) Potri.004G063400 [exp] 115 / 1e-34 AT2G34480 345 / 1e-123 Ribosomal protein L18ae/LX family protein (.1) Potri.004G063300 [exp] 115 / 1e-34 AT2G34480 345 / 1e-123 Ribosomal protein L18ae/LX family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10023453 pacid=23160631 polypeptide=Lus10023453 locus=Lus10023453.g ID=Lus10023453.BGIv1.0 annot-version=v1.0 ATGACGAGATGGCTTCTCGTCAGGGTAAGGTCTCCATGCATCCAGATCATCAAGACCGCCACCATCCCAGCTAAGCTACGCAAGAGGGAGAGCACCAAGC AGTTCCACAACTCAAAGATCAAATTCCCGCTGGTGTTCAAGAAGGTTAGGCCACCAACCAGGAAGCTGAAGACCACGTACAAGGCATCGAGGCCCAACTT GTTCGTCTAA
AA sequence Show only first row Show all	>Lus10023453 pacid=23160631 polypeptide=Lus10023453 locus=Lus10023453.g ID=Lus10023453.BGIv1.0 annot-version=v1.0 MTRWLLVRVRSPCIQIIKTATIPAKLRKRESTKQFHNSKIKFPLVFKKVRPPTRKLKTTYKASRPNLFV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G34480			Ribosomal protein L18ae/LX fam...		Lus10023453 [exp]	0	1
AT5G06540			Pentatricopeptide repeat (PPR)...		Lus10031424 [exp]	1.4	0.9103
AT1G31860		HISN2, AT-IE	HISTIDINE BIOSYNTHESIS 2, hist...		Lus10043483 [exp]	2.4	0.8641
AT1G02000		GAE2	UDP-D-glucuronate 4-epimerase ...		Lus10031707 [exp]	4.9	0.8249
					Lus10015488 [exp]	6.3	0.8893
AT2G44820			unknown protein		Lus10026825 [exp]	7.3	0.8494
AT3G45070			P-loop containing nucleoside t...		Lus10003068 [exp]	7.5	0.8588
					Lus10018970 [exp]	7.7	0.8505
AT1G61420			S-locus lectin protein kinase ...		Lus10019600 [exp]	8.8	0.8356
AT1G04480			Ribosomal protein L14p/L23e fa...		Lus10008065 [exp]	8.9	0.8362
AT1G50420	GRAS	SCL-3, SCL3	scarecrow-like 3 (.1)		Lus10016892 [exp]	10.2	0.8394

Compare expression of checked genes

Lus10023453 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.