Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G34480 147 / 1e-46 Ribosomal protein L18ae/LX family protein (.1) AT1G29965 145 / 7e-46 Ribosomal protein L18ae/LX family protein (.1) AT3G14600 144 / 1e-45 Ribosomal protein L18ae/LX family protein (.1) AT1G29970 145 / 2e-44 RPL18AA 60S ribosomal protein L18A-1 (.1.2.3)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040332 [exp] 160 / 2e-52 AT2G34480 290 / 4e-102 Ribosomal protein L18ae/LX family protein (.1) Lus10019881 [exp] 160 / 4e-52 AT2G34480 337 / 4e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10023454 [exp] 160 / 4e-52 AT2G34480 337 / 4e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10023457 [exp] 160 / 5e-52 AT2G34480 337 / 2e-120 Ribosomal protein L18ae/LX family protein (.1) Lus10014035 [exp] 161 / 4e-50 AT2G34480 338 / 2e-117 Ribosomal protein L18ae/LX family protein (.1) Lus10023453 [exp] 120 / 2e-37 AT2G34480 112 / 4e-33 Ribosomal protein L18ae/LX family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G057600 [exp] 156 / 2e-50 AT2G34480 342 / 3e-122 Ribosomal protein L18ae/LX family protein (.1) Potri.004G063400 [exp] 151 / 2e-48 AT2G34480 345 / 1e-123 Ribosomal protein L18ae/LX family protein (.1) Potri.004G063300 [exp] 151 / 2e-48 AT2G34480 345 / 1e-123 Ribosomal protein L18ae/LX family protein (.1) Potri.011G072400 [exp] 151 / 2e-48 AT2G34480 349 / 4e-125 Ribosomal protein L18ae/LX family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF01775 [flax] [poplar] Ribosomal_L18A Ribosomal proteins 50S-L18Ae/60S-L20/60S-L18A
Representative CDS sequence Show only first row Show all	>Lus10023456 pacid=23160534 polypeptide=Lus10023456 locus=Lus10023456.g ID=Lus10023456.BGIv1.0 annot-version=v1.0 ATGTACAAGAAATTCTGTGACACTACCTTGAACGACGCTGTCAACCAGATGTATGATGAGATGGTTTCTCGTCACAGGGTAAGGTCTCCATGCATCCAGG TCATCAAGACCGCCACCATCCCAGCTAAGCTACGCAAGAGGGAGAGCACCAAGCAGTTCCACAACTCAAATATCAAGTTCCCGCTGGTGTTCAAGAAGAT TAGGCCACCAACCAGGGAGCTGAAGACCACGTACAAGGCATCGAGGCCCAACTTGTTCGTCTAA
AA sequence Show only first row Show all	>Lus10023456 pacid=23160534 polypeptide=Lus10023456 locus=Lus10023456.g ID=Lus10023456.BGIv1.0 annot-version=v1.0 MYKKFCDTTLNDAVNQMYDEMVSRHRVRSPCIQVIKTATIPAKLRKRESTKQFHNSNIKFPLVFKKIRPPTRELKTTYKASRPNLFV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G34480			Ribosomal protein L18ae/LX fam...		Lus10023456 [exp]	0	1
AT1G51405			myosin-related (.1)		Lus10009954 [exp]	3.3	0.7778
AT2G02850		ARPN	plantacyanin (.1)		Lus10028640 [exp]	30.2	0.6739
AT3G57630			exostosin family protein (.1.2...		Lus10042357 [exp]	32.5	0.6913
					Lus10011647 [exp]	41.8	0.6152
AT2G02850		ARPN	plantacyanin (.1)		Lus10018938 [exp]	46.3	0.6660
AT2G02850		ARPN	plantacyanin (.1)		Lus10028641 [exp]	67.1	0.6552
AT1G13570			F-box/RNI-like superfamily pro...		Lus10006346 [exp]	86.3	0.6248
AT5G66530			Galactose mutarotase-like supe...		Lus10041758 [exp]	92.0	0.6239
AT2G43840		UGT74F1	UDP-glycosyltransferase 74 F1 ...		Lus10017825 [exp]	111.4	0.6261
AT3G49250		IDN1, DMS3	INVOLVED IN DE NOVO 1, defecti...		Lus10003997 [exp]	112.4	0.6211

Compare expression of checked genes

Lus10023456 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.