Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G74875 66 / 4e-14 unknown protein AT1G67623 49 / 8e-08 F-box family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10030128 [exp] 149 / 2e-46 AT1G67623 71 / 2e-14 F-box family protein (.1) Lus10005844 [exp] 145 / 2e-46 AT1G67623 76 / 3e-17 F-box family protein (.1) Lus10022147 [exp] 142 / 8e-45 AT1G67623 78 / 5e-18 F-box family protein (.1) Lus10038709 [exp] 131 / 4e-39 AT1G67623 90 / 3e-21 F-box family protein (.1) Lus10037978 [exp] 129 / 2e-38 AT1G67623 82 / 3e-18 F-box family protein (.1) Lus10038720 [exp] 70 / 3e-16 ND 41 / 8e-05 Lus10006434 [exp] 41 / 6e-05 AT1G67623 61 / 1e-10 F-box family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G008800 [exp] 102 / 7e-28 AT1G74875 110 / 2e-29 unknown protein Potri.001G321400 [exp] 95 / 3e-25 AT1G67623 102 / 6e-26 F-box family protein (.1) Potri.015G096200 [exp] 40 / 9e-05 AT1G67340 438 / 3e-154 HCP-like superfamily protein with MYND-type zinc finger (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10023768 pacid=23151420 polypeptide=Lus10023768 locus=Lus10023768.g ID=Lus10023768.BGIv1.0 annot-version=v1.0 ATGGTAGCCACCACATCCTCCGCTAACTTTGTCAACGCAGAATTGACATGCAAGGCCCTGTTATACGCTTCCACAGACGACTACGCCTACTGCCACATCG AGATCTCCAAAATCCCCCTCATGCCTTGGAAGATCCACCACCAATCTGTCCTCTATCAATGTGTAACCTGTTGCAACCTTGAGGCTTTGTTCCGTCGAGG CATGGTCGAGTTCTTCGGTTCGGATGAGATTCAGTCAGGCCTTGCTAATTTAATGTCTCCAGCCCGGTCGGGTCACCTGGAATCGATCTATGTTTGTGAC ATCGTCTGTTGTGCCTTGGCCAGGAGGAAGAAGGGATGA
AA sequence Show only first row Show all	>Lus10023768 pacid=23151420 polypeptide=Lus10023768 locus=Lus10023768.g ID=Lus10023768.BGIv1.0 annot-version=v1.0 MVATTSSANFVNAELTCKALLYASTDDYAYCHIEISKIPLMPWKIHHQSVLYQCVTCCNLEALFRRGMVEFFGSDEIQSGLANLMSPARSGHLESIYVCD IVCCALARRKKG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G74875			unknown protein		Lus10023768 [exp]	0	1
AT4G04750			Major facilitator superfamily ...		Lus10033795 [exp]	2.4	0.9037
AT5G25840			Protein of unknown function (D...		Lus10037569 [exp]	5.3	0.8709
AT1G75900		EXL3	GDSL-like Lipase/Acylhydrolase...		Lus10041878 [exp]	5.7	0.8943
AT1G08810	MYB	ATMYB60	myb domain protein 60 (.1.2)		Lus10009522 [exp]	6.7	0.8788
AT3G21090		ABCG15	ATP-binding cassette G15, ABC-...		Lus10009961 [exp]	10.0	0.8608
AT4G25830			Uncharacterised protein family...		Lus10019999 [exp]	11.2	0.8540
AT4G25830			Uncharacterised protein family...		Lus10015528 [exp]	11.8	0.8489
AT5G23210		SCPL34	serine carboxypeptidase-like 3...		Lus10010190 [exp]	12.0	0.8493
AT3G24503		ALDH1A, REF1, A...	REDUCED EPIDERMAL FLUORESCENCE...		Lus10023626 [exp]	12.4	0.8539
AT2G47240		CER8, LACS1	LONG-CHAIN ACYL-COA SYNTHASE 1...		Lus10032840 [exp]	13.6	0.8528

Compare expression of checked genes

Lus10023768 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.