Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G11720 66 / 2e-13 HAP2, GCS1 GENERATIVE CELL-SPECIFIC 1, hapless 2 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10029584 [exp] 56 / 6e-10 AT4G11720 830 / 0.0 GENERATIVE CELL-SPECIFIC 1, hapless 2 (.1) Lus10006315 [exp] 52 / 9e-09 AT4G11720 689 / 0.0 GENERATIVE CELL-SPECIFIC 1, hapless 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G109000 [exp] 67 / 7e-14 AT4G11720 936 / 0.0 GENERATIVE CELL-SPECIFIC 1, hapless 2 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10024496 pacid=23170220 polypeptide=Lus10024496 locus=Lus10024496.g ID=Lus10024496.BGIv1.0 annot-version=v1.0 ATGGAACGCCAGGCGTTCTGCATCGCCCCCATCTGTTGCTTGCTTCTTCTGTTATCGAGCTTCACCGCTAGCGGAGTCGAGATACTCAAAACTCAAAGGG TGGGAGAGTCCTCGATCGTAACAGAAATAGTTGAGGCGGAGGAGAATCCCACCGACTACATGCAAACATTGCGAAGACTGCCAGTTGTATCAGTCAGCAA ATCTGCTGCCTATGCACTCTACCAGCTTACTTACATTCGGGAAAAGGTTAAGCAGGAAGTCCATTTTGGAGGAATGGAAAATGGCATTGTCTGGTATGAT ATTTCACGCATGGAGGCCATTGGTCGATTCCAGTTTAATCTTACTGAAGTCTACAACTGTTGGTTTTAG
AA sequence Show only first row Show all	>Lus10024496 pacid=23170220 polypeptide=Lus10024496 locus=Lus10024496.g ID=Lus10024496.BGIv1.0 annot-version=v1.0 MERQAFCIAPICCLLLLLSSFTASGVEILKTQRVGESSIVTEIVEAEENPTDYMQTLRRLPVVSVSKSAAYALYQLTYIREKVKQEVHFGGMENGIVWYD ISRMEAIGRFQFNLTEVYNCWF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G11720		HAP2, GCS1	GENERATIVE CELL-SPECIFIC 1, ha...		Lus10024496 [exp]	0	1
AT5G40480		EMB3012	embryo defective 3012 (.1)		Lus10002516 [exp]	15.4	0.8084
AT2G01820		CYCJ18	Leucine-rich repeat protein ki...		Lus10001851 [exp]	15.4	0.8484
AT1G64790		ILA	ILITYHIA (.1.2)		Lus10003101 [exp]	22.6	0.8634
AT5G57280		RID2	root initiation defective 2, S...		Lus10020005 [exp]	22.9	0.7906
AT2G33680			Tetratricopeptide repeat (TPR)...		Lus10005643 [exp]	23.0	0.7962
					Lus10009498 [exp]	27.1	0.8575
AT1G11160			Transducin/WD40 repeat-like su...		Lus10018458 [exp]	32.6	0.8573
					Lus10004082 [exp]	46.7	0.8474
AT3G22690			unknown protein		Lus10039355 [exp]	47.1	0.8311
					Lus10002716 [exp]	48.2	0.8209

Compare expression of checked genes

Lus10024496 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.