Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G02160 106 / 4e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10032273 [exp] 147 / 3e-48 AT1G02160 103 / 4e-31 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G051850 [exp] 119 / 4e-37 AT1G02160 107 / 2e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10024637 pacid=23161510 polypeptide=Lus10024637 locus=Lus10024637.g ID=Lus10024637.BGIv1.0 annot-version=v1.0 ATGGCATCTAAAACAGCCACCGCCGGAGAAGCAACTCCTTACCAGAGTGCAGCCAGGATATCCGATTCCCAATGCTTCCCTCAATACTCCGCTTCTCTCA AGTGCCTGGAGCAGTTCAGCACAGACAAGAGCAAGTGTCAGCAGCATTTTGACATCTACAAAGAATGCAAGAAAAAAGAGAGGGAAGCTAGGCTAGAACG CAACAAGACCCGCTCCTTGTTTTCTTGA
AA sequence Show only first row Show all	>Lus10024637 pacid=23161510 polypeptide=Lus10024637 locus=Lus10024637.g ID=Lus10024637.BGIv1.0 annot-version=v1.0 MASKTATAGEATPYQSAARISDSQCFPQYSASLKCLEQFSTDKSKCQQHFDIYKECKKKEREARLERNKTRSLFS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G02160			Cox19 family protein (CHCH mot...		Lus10024637 [exp]	0	1
AT1G47830			SNARE-like superfamily protein...		Lus10024337 [exp]	6.8	0.7898
AT2G36130			Cyclophilin-like peptidyl-prol...		Lus10017010 [exp]	8.9	0.8291
AT5G04910			unknown protein		Lus10008941 [exp]	11.9	0.8248
AT4G32930			unknown protein		Lus10005503 [exp]	16.7	0.8283
AT5G59140			BTB/POZ domain-containing prot...		Lus10040746 [exp]	23.8	0.8226
AT3G07570			Cytochrome b561/ferric reducta...		Lus10012305 [exp]	27.4	0.7796
AT1G76200			unknown protein		Lus10016001 [exp]	27.7	0.8015
AT5G64180			unknown protein		Lus10008120 [exp]	29.1	0.7970
AT4G17010			unknown protein		Lus10001160 [exp]	33.8	0.8117
AT1G05205			unknown protein		Lus10039669 [exp]	34.3	0.8097

Compare expression of checked genes

Lus10024637 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.