Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G06135 40 / 1e-05 unknown protein AT2G31345 37 / 0.0003 unknown protein AT1G06137 35 / 0.001 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024873 [exp] 115 / 2e-34 ND 37 / 2e-04 Lus10000703 [exp] 100 / 1e-28 AT1G06135 44 / 3e-07 unknown protein Lus10014739 [exp] 71 / 3e-17 ND 40 / 2e-05 Lus10006567 [exp] 52 / 9e-10 ND 35 / 0.001 Lus10005525 [exp] 52 / 2e-09 ND 40 / 1e-05
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G043600 [exp] 57 / 2e-11 AT1G06135 39 / 3e-05 unknown protein Potri.002G041950 [exp] 50 / 7e-09 AT2G31335 / unknown protein Potri.005G221200 [exp] 49 / 1e-08 AT2G31335 / unknown protein Potri.001G380300 [exp] 48 / 3e-08 AT1G06137 40 / 2e-05 unknown protein Potri.019G013000 [exp] 48 / 4e-08 AT2G31335 / unknown protein Potri.019G012400 [exp] 43 / 3e-06 AT2G31335 / unknown protein Potri.019G012702 [exp] 42 / 9e-06 AT2G31335 / unknown protein Potri.008G163000 [exp] 42 / 9e-06 AT2G31335 40 / 1e-05 unknown protein Potri.019G012700 [exp] 41 / 1e-05 AT2G31335 / unknown protein Potri.019G012900 [exp] 41 / 2e-05 AT2G31335 / unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10024872 pacid=23178915 polypeptide=Lus10024872 locus=Lus10024872.g ID=Lus10024872.BGIv1.0 annot-version=v1.0 ATGGGTTTTCTATCACGAAGAAAGTCGAGCAGTACCGCGGTTTGCTGCATCCTTTTGGTTTTGGTTATTTCGGCTTCTTGTTTCCGGCCTGCTGAAATGA GGCCGTTGAAGGAAGAATATGGCGGCGGCGATCATCGTCATAACAAATTACTAACCGTGATACAGTCTCTACAAAGGGGTCCGGTTCGAGGGTCGGGTCC GAATCCATGCACCAACATATCGGGTCGGAACAGGGGAATATGCACCCGTGCTACCGTCGGTACCATGAACGTCGCCGGCAATGTGTTCGTCCGGTCGCCT CCTCTAGCCGTAGTAGACAAAAGAGAATCTTGGTCGTCGTGA
AA sequence Show only first row Show all	>Lus10024872 pacid=23178915 polypeptide=Lus10024872 locus=Lus10024872.g ID=Lus10024872.BGIv1.0 annot-version=v1.0 MGFLSRRKSSSTAVCCILLVLVISASCFRPAEMRPLKEEYGGGDHRHNKLLTVIQSLQRGPVRGSGPNPCTNISGRNRGICTRATVGTMNVAGNVFVRSP PLAVVDKRESWSS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10024872 [exp]	0	1
AT1G08080		ATACA7, ACA7	A. THALIANA ALPHA CARBONIC ANH...		Lus10021455 [exp]	1.4	0.9904
AT2G42360			RING/U-box superfamily protein...		Lus10005105 [exp]	2.8	0.9887
AT5G52400		CYP715A1	"cytochrome P450, family 715, ...		Lus10027480 [exp]	5.7	0.9796
					Lus10014508 [exp]	6.2	0.9901
AT3G48320		CYP71A21	"cytochrome P450, family 71, s...		Lus10019460 [exp]	8.1	0.9894
AT4G08250	GRAS		GRAS family transcription fact...		Lus10028056 [exp]	9.2	0.9848
AT4G15560		AtCLA1, DXS, DX...	1-DEOXY-D-XYLULOSE 5-PHOSPHATE...		Lus10006984 [exp]	11.2	0.9879
AT2G47140		AtSDR5	short-chain dehydrogenase redu...		Lus10034626 [exp]	11.6	0.9861
AT5G05600			2-oxoglutarate (2OG) and Fe(II...		Lus10004808 [exp]	12.0	0.9825
AT3G26330		CYP71B37	"cytochrome P450, family 71, s...		Lus10033633 [exp]	12.7	0.9870

Compare expression of checked genes

Lus10024872 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.