Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G38540 59 / 3e-11 FAD/NAD(P)-binding oxidoreductase family protein (.1) AT2G29720 58 / 4e-11 CTF2B FAD/NAD(P)-binding oxidoreductase family protein (.1) AT2G35660 57 / 1e-10 CTF2B, CTF2A FAD/NAD(P)-binding oxidoreductase family protein (.1), FAD/NAD(P)-binding oxidoreductase family protein (.2), FAD/NAD(P)-binding oxidoreductase family protein (.3) AT5G05320 53 / 2e-09 FAD/NAD(P)-binding oxidoreductase family protein (.1) AT4G15760 50 / 3e-08 MO1 monooxygenase 1 (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10034467 [exp] 117 / 1e-32 AT4G38540 418 / 4e-145 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10019729 [exp] 108 / 2e-29 AT4G38540 400 / 4e-138 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10016398 [exp] 107 / 2e-28 AT4G38540 358 / 1e-119 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10019728 [exp] 103 / 1e-27 AT5G05320 208 / 4e-64 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10016392 [exp] 95 / 3e-24 AT5G05320 377 / 4e-129 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10025068 [exp] 80 / 9e-19 AT5G05320 410 / 1e-141 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10034475 [exp] 78 / 3e-18 AT5G05320 407 / 2e-140 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10034468 [exp] 68 / 2e-14 AT5G05320 232 / 7e-73 FAD/NAD(P)-binding oxidoreductase family protein (.1) Lus10000593 [exp] 56 / 2e-10 AT2G35660 639 / 0.0 FAD/NAD(P)-binding oxidoreductase family protein (.1), FAD/NAD(P)-binding oxidoreductase family protein (.2), FAD/NAD(P)-binding oxidoreductase family protein (.3)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G176950 [exp] 86 / 5e-21 AT4G38540 413 / 4e-143 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.004G176750 [exp] 85 / 1e-20 AT4G38540 419 / 4e-145 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.001G152600 [exp] 56 / 2e-10 AT2G35660 658 / 0.0 FAD/NAD(P)-binding oxidoreductase family protein (.1), FAD/NAD(P)-binding oxidoreductase family protein (.2), FAD/NAD(P)-binding oxidoreductase family protein (.3) Potri.001G307500 [exp] 51 / 1e-08 AT4G38540 295 / 1e-96 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003400 [exp] 44 / 5e-06 AT4G38540 283 / 4e-92 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003200 [exp] 42 / 2e-05 AT4G38540 268 / 2e-86 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003800 [exp] 42 / 3e-05 AT5G05320 273 / 3e-88 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003700 [exp] 40 / 6e-05 AT4G38540 256 / 9e-82 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003500 [exp] 40 / 7e-05 AT5G05320 273 / 4e-88 FAD/NAD(P)-binding oxidoreductase family protein (.1) Potri.019G003300 [exp] 40 / 7e-05 AT5G05320 272 / 1e-87 FAD/NAD(P)-binding oxidoreductase family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0063 [flax] [poplar] NADP_Rossmann PF01494 [flax] [poplar] FAD_binding_3 FAD binding domain
Representative CDS sequence Show only first row Show all	>Lus10025074 pacid=23167788 polypeptide=Lus10025074 locus=Lus10025074.g ID=Lus10025074.BGIv1.0 annot-version=v1.0 ATGGCGGCAGCGTTGCAAGAAGAAGTAGAAAATGAAGACGTCGTCGGAGCTGGTATAGCGGGTCTCGCCAGTTCCTTAGCTCTCCACAGGCTCGGAATCA AAACCCTGGTGTTGGAATCAGCTTCGAGCTTACGAACTGCTGGGTTCGCTCTGGGGATATGGACCAACGCTTGGAGAGCTCTAGACGCTCTCTGTATAGG GGATTCTCTTGGGCGACAACACCATCTGCTTAACGGGGTGGTTACTACTTCCACGGTTACAGGACGGATCACCGCCCAAGTGTCGTTTGCTGGTAGTGGG CATGAATTGCGATGA
AA sequence Show only first row Show all	>Lus10025074 pacid=23167788 polypeptide=Lus10025074 locus=Lus10025074.g ID=Lus10025074.BGIv1.0 annot-version=v1.0 MAAALQEEVENEDVVGAGIAGLASSLALHRLGIKTLVLESASSLRTAGFALGIWTNAWRALDALCIGDSLGRQHHLLNGVVTTSTVTGRITAQVSFAGSG HELR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G38540			FAD/NAD(P)-binding oxidoreduct...		Lus10025074 [exp]	0	1
					Lus10027601 [exp]	5.5	0.7098
AT1G04110		SDD1	STOMATAL DENSITY AND DISTRIBUT...		Lus10029577 [exp]	5.5	0.6743
AT4G37370		CYP81D8	"cytochrome P450, family 81, s...		Lus10024816 [exp]	9.3	0.7025
AT1G08510		FATB	fatty acyl-ACP thioesterases B...		Lus10035900 [exp]	22.6	0.6608
					Lus10014737 [exp]	23.3	0.6608
					Lus10019558 [exp]	24.0	0.6608
AT4G16195			Plant self-incompatibility pro...		Lus10019768 [exp]	24.7	0.6608
					Lus10021773 [exp]	25.3	0.6608
AT3G04060	NAC	ANAC046	NAC domain containing protein ...		Lus10033699 [exp]	25.9	0.6608
AT1G04520		PDLP2	plasmodesmata-located protein ...		Lus10028049 [exp]	26.5	0.6608

Compare expression of checked genes

Lus10025074 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.