Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G64960 105 / 7e-28 HEB1 hypersensitive to excess boron 1, ARM repeat superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002459 [exp] 197 / 5e-60 AT1G64960 882 / 0.0 hypersensitive to excess boron 1, ARM repeat superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G055400 [exp] 127 / 2e-35 AT1G64960 1127 / 0.0 hypersensitive to excess boron 1, ARM repeat superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10025198 pacid=23167779 polypeptide=Lus10025198 locus=Lus10025198.g ID=Lus10025198.BGIv1.0 annot-version=v1.0 ATGGATGCCATTGGTTTGATTTTCTTAACAGGATCATCTGTCGGATTGGAAAGAAAGGAGTTTGGATTAGTACTGGGGATGCTCCGCTTTGGGTGCCACA AACTTGTGGGGAAAGAGGATAGAGAATGGAGTCAACTTGATGGGATGTTGGCTTCCCTCCCAAGCATTTTCCCTCAAATTGAGAGGGAGGTTGAGTTGAA AAATTGTGGTGAAGATTCGAGTAAGGAATTGGACAAGGATAGAGAATTGCTTGAACCAGTTTGGTTGTACCATATCTATGAAACTGAGAGGTTTCGTGCA ACTGAGGAATAA
AA sequence Show only first row Show all	>Lus10025198 pacid=23167779 polypeptide=Lus10025198 locus=Lus10025198.g ID=Lus10025198.BGIv1.0 annot-version=v1.0 MDAIGLIFLTGSSVGLERKEFGLVLGMLRFGCHKLVGKEDREWSQLDGMLASLPSIFPQIEREVELKNCGEDSSKELDKDRELLEPVWLYHIYETERFRA TEE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G64960		HEB1	hypersensitive to excess boron...		Lus10025198 [exp]	0	1
AT1G64960		HEB1	hypersensitive to excess boron...		Lus10025197 [exp]	1.0	0.9696
AT5G51780	bHLH	bHLH036	basic helix-loop-helix (bHLH) ...		Lus10031677 [exp]	2.0	0.9388
					Lus10017966 [exp]	2.0	0.9607
AT2G21540		ATSFH3	SEC14-like 3 (.1.2.3)		Lus10042303 [exp]	2.4	0.9419
AT3G02100			UDP-Glycosyltransferase superf...		Lus10003453 [exp]	4.4	0.9047
AT5G51780	bHLH	bHLH036	basic helix-loop-helix (bHLH) ...		Lus10027394 [exp]	4.9	0.9180
AT2G38750		ANNAT4	annexin 4 (.1)		Lus10024171 [exp]	6.0	0.9340
AT5G47060			Protein of unknown function (D...		Lus10043343 [exp]	7.7	0.9190
AT5G04820	OFP	ATOFP13, OFP13	ARABIDOPSIS THALIANA OVATE FAM...		Lus10043433 [exp]	8.0	0.9094
AT1G09570		FHY2, HY8, FRE1...	ELONGATED HYPOCOTYL 8, FAR RED...		Lus10007594 [exp]	8.5	0.9302

Compare expression of checked genes

Lus10025198 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.