Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G15780 42 / 7e-06 unknown protein AT1G15790 41 / 1e-05 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015322 [exp] 150 / 5e-44 AT1G15780 164 / 1e-41 unknown protein Lus10025452 [exp] 61 / 2e-12 AT1G15780 248 / 3e-68 unknown protein Lus10015323 [exp] 59 / 8e-12 AT1G15780 587 / 0.0 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G012400 [exp] 43 / 6e-06 AT1G15780 557 / 2e-175 unknown protein Potri.003G026510 [exp] 40 / 3e-05 AT1G15780 160 / 2e-46 unknown protein Potri.003G028089 [exp] 39 / 0.0001 AT1G15780 223 / 5e-60 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10025449 pacid=23150824 polypeptide=Lus10025449 locus=Lus10025449.g ID=Lus10025449.BGIv1.0 annot-version=v1.0 ATGCCCAAAATTGCACCGATGAATGCCCCGAAGCTTGAAGTCGAAGATCCTATCTCGGAGAATGTTTCATTGAAGATGGTCGAAATGGAGAGCGAATCAC AGCTGCCAGCAGGCTACGACAGTAAACTCCCTGATATGGATGGGAATATTTTGATGCCTGCTGTTCCAGTGGGAGAAGCTGCTGTGGAAGGGGGTGACTG GAGAGCTACATTGCAGGCCGACTCGAGGCAGGGAATCAGGAACAAAATGTGA
AA sequence Show only first row Show all	>Lus10025449 pacid=23150824 polypeptide=Lus10025449 locus=Lus10025449.g ID=Lus10025449.BGIv1.0 annot-version=v1.0 MPKIAPMNAPKLEVEDPISENVSLKMVEMESESQLPAGYDSKLPDMDGNILMPAVPVGEAAVEGGDWRATLQADSRQGIRNKM

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G15780			unknown protein		Lus10025449 [exp]	0	1
AT3G12150			unknown protein		Lus10021026 [exp]	19.0	0.6052
					Lus10031263 [exp]	25.0	0.5669
					Lus10028008 [exp]	25.7	0.5174
AT5G09310			unknown protein		Lus10041297 [exp]	28.5	0.5821
					Lus10033498 [exp]	28.7	0.5785
AT4G39010		ATGH9B18	glycosyl hydrolase 9B18 (.1)		Lus10042071 [exp]	37.8	0.5060
AT5G55380			MBOAT (membrane bound O-acyl t...		Lus10003655 [exp]	51.1	0.5012
					Lus10021106 [exp]	62.5	0.5469
AT1G56430		ATNAS4	ARABIDOPSIS THALIANA NICOTIANA...		Lus10029843 [exp]	64.0	0.5462
AT4G24050			NAD(P)-binding Rossmann-fold s...		Lus10003204 [exp]	90.6	0.5315

Compare expression of checked genes

Lus10025449 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.