Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G70250 85 / 1e-20 receptor serine/threonine kinase, putative (.1) AT1G67000 82 / 1e-19 Protein kinase superfamily protein (.1) AT5G38280 81 / 2e-19 PR5K PR5-like receptor kinase (.1) AT1G66930 79 / 1e-18 Protein kinase superfamily protein (.1) AT1G66980 78 / 2e-18 GDPDL2, SNC4 Glycerophosphodiester phosphodiesterase \(GDPD\) like 2, suppressor of npr1-1 constitutive 4 (.1) AT5G39020 78 / 3e-18 Malectin/receptor-like protein kinase family protein (.1) AT5G39030 77 / 5e-18 Protein kinase superfamily protein (.1) AT5G38250 75 / 3e-17 Protein kinase family protein (.1) AT1G66920 75 / 3e-17 Protein kinase superfamily protein (.1.2) AT1G66910 75 / 4e-17 Protein kinase superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025492 [exp] 138 / 1e-39 AT5G38260 326 / 1e-102 Protein kinase superfamily protein (.1) Lus10025544 [exp] 113 / 4e-31 AT5G39020 217 / 1e-62 Malectin/receptor-like protein kinase family protein (.1) Lus10022359 [exp] 112 / 2e-30 AT1G66980 322 / 3e-101 Glycerophosphodiester phosphodiesterase \(GDPD\) like 2, suppressor of npr1-1 constitutive 4 (.1) Lus10025545 [exp] 104 / 2e-28 AT5G39020 316 / 1e-101 Malectin/receptor-like protein kinase family protein (.1) Lus10008335 [exp] 103 / 2e-27 AT1G70250 316 / 8e-98 receptor serine/threonine kinase, putative (.1) Lus10027085 [exp] 100 / 3e-27 AT1G66980 275 / 1e-84 Glycerophosphodiester phosphodiesterase \(GDPD\) like 2, suppressor of npr1-1 constitutive 4 (.1) Lus10025549 [exp] 99 / 5e-27 AT1G66980 209 / 1e-62 Glycerophosphodiester phosphodiesterase \(GDPD\) like 2, suppressor of npr1-1 constitutive 4 (.1) Lus10027006 [exp] 86 / 3e-21 AT1G66980 218 / 1e-66 Glycerophosphodiester phosphodiesterase \(GDPD\) like 2, suppressor of npr1-1 constitutive 4 (.1) Lus10008361 [exp] 77 / 5e-20 AT1G70250 62 / 4e-13 receptor serine/threonine kinase, putative (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G018600 [exp] 90 / 1e-22 AT1G66920 351 / 9e-113 Protein kinase superfamily protein (.1.2) Potri.007G125800 [exp] 89 / 3e-22 AT5G38260 308 / 1e-95 Protein kinase superfamily protein (.1) Potri.007G125450 [exp] 86 / 3e-21 AT5G38260 300 / 2e-92 Protein kinase superfamily protein (.1) Potri.007G125000 [exp] 84 / 1e-20 AT5G38260 318 / 7e-100 Protein kinase superfamily protein (.1) Potri.017G117010 [exp] 83 / 4e-20 AT5G38260 398 / 3e-130 Protein kinase superfamily protein (.1) Potri.017G034500 [exp] 79 / 4e-19 AT5G38260 336 / 6e-111 Protein kinase superfamily protein (.1) Potri.017G117285 [exp] 80 / 5e-19 AT1G66920 439 / 2e-146 Protein kinase superfamily protein (.1.2) Potri.007G125200 [exp] 79 / 2e-18 AT5G38260 300 / 2e-94 Protein kinase superfamily protein (.1) Potri.017G116900 [exp] 77 / 5e-18 AT1G66910 477 / 2e-160 Protein kinase superfamily protein (.1) Potri.004G076500 [exp] 76 / 1e-17 AT5G38260 409 / 1e-134 Protein kinase superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10025555 pacid=23145034 polypeptide=Lus10025555 locus=Lus10025555.g ID=Lus10025555.BGIv1.0 annot-version=v1.0 ATGGTGGTAGGAGATGCTACTGAAGAGGAAAATACCTTTTCGAAGAAGATGGTTATAGTAGGATTGTGGTGTATCCAGACAAATCCCGGGAACCGTCCTC CGATGAATAAAGTGGTGGAGATGCTTGAAGGAGAGTTGGAAAGCTTGCAATTGCCTCCTAGACCAGTTCTGTATGCTGGAGAAAATTTGACAAAGAATGA AGAAGGATTGTCATCATACGTATCATCATATGTGTCCTCTGACTATTCAGAATCAATGAGTCAAGAGTGA
AA sequence Show only first row Show all	>Lus10025555 pacid=23145034 polypeptide=Lus10025555 locus=Lus10025555.g ID=Lus10025555.BGIv1.0 annot-version=v1.0 MVVGDATEEENTFSKKMVIVGLWCIQTNPGNRPPMNKVVEMLEGELESLQLPPRPVLYAGENLTKNEEGLSSYVSSYVSSDYSESMSQE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G70250			receptor serine/threonine kina...		Lus10025555 [exp]	0	1
AT2G19460			Protein of unknown function (D...		Lus10027629 [exp]	1.0	0.9396
AT3G01850			Aldolase-type TIM barrel famil...		Lus10035219 [exp]	7.2	0.9359
AT5G38260			Protein kinase superfamily pro...		Lus10025554 [exp]	12.1	0.8873
AT4G28400			Protein phosphatase 2C family ...		Lus10008556 [exp]	13.1	0.9228
					Lus10035552 [exp]	13.4	0.9028
AT5G41350			RING/U-box superfamily protein...		Lus10032270 [exp]	13.4	0.9194
AT3G05660		AtRLP33	receptor like protein 33 (.1)		Lus10002214 [exp]	16.6	0.9181
AT3G16910		AAE7, ACN1	ACETATE NON-UTILIZING 1, acyl-...		Lus10016870 [exp]	17.2	0.9143
AT4G16210		ECHIA, E-COAH-2	ENOYL-COA HYDRATASE 2, enoyl-C...		Lus10016920 [exp]	18.4	0.9083
AT2G29050		ATRBL1	RHOMBOID-like 1 (.1.2)		Lus10023789 [exp]	20.8	0.8926

Compare expression of checked genes

Lus10025555 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.