Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G74470 130 / 5e-37 Pyridine nucleotide-disulphide oxidoreductase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008405 [exp] 214 / 4e-69 AT1G74470 536 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1) Lus10001642 [exp] 127 / 1e-35 AT1G74470 782 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1) Lus10021665 [exp] 126 / 2e-35 AT1G74470 784 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G195800 [exp] 152 / 2e-45 AT1G74470 521 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1) Potri.009G157700 [exp] 152 / 3e-45 AT1G74470 517 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1) Potri.012G068801 [exp] 125 / 5e-35 AT1G74470 774 / 0.0 Pyridine nucleotide-disulphide oxidoreductase family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10026772 pacid=23176610 polypeptide=Lus10026772 locus=Lus10026772.g ID=Lus10026772.BGIv1.0 annot-version=v1.0 ATGACGTTCCAGGAGCGAATCCGTCTCGTGGAGGCGTCGGAAGGAGGGGAGAAGATGATCGGAGAGGCGGATCTGAAGAGGGAGTATCTCCGGCGGTGGG ACGGCGAGTTCTCGACGACGTTCAGGTTTCTGGACGCGCTGCAGAGCGTGTTCTACAGAAGCAACGCGGCTAGGGAGGCGCTGGTGGAGCTGTGTGGAGA CGAGTATGTGCAGAGGATGACGTTCGATAGCTATCTGTATAAGAAGCTGGCTGCGAGGAACGGGTGGGAGGATGTGAGGATGGCGGCGAATACGATCGGG AGCTTGATACGGTGCTGGATTGTTGGCCGGGGTGGCTGTGGTGAGGCGGCGGAGGGTTTTAGTAGGTTTGTTTGA
AA sequence Show only first row Show all	>Lus10026772 pacid=23176610 polypeptide=Lus10026772 locus=Lus10026772.g ID=Lus10026772.BGIv1.0 annot-version=v1.0 MTFQERIRLVEASEGGEKMIGEADLKREYLRRWDGEFSTTFRFLDALQSVFYRSNAAREALVELCGDEYVQRMTFDSYLYKKLAARNGWEDVRMAANTIG SLIRCWIVGRGGCGEAAEGFSRFV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G74470			Pyridine nucleotide-disulphide...		Lus10026772 [exp]	0	1
AT5G51980	C3HZnF		Transducin/WD40 repeat-like su...		Lus10015010 [exp]	3.6	0.8913
AT3G15010			RNA-binding (RRM/RBD/RNP motif...		Lus10023817 [exp]	16.2	0.8855
AT1G13190			RNA-binding (RRM/RBD/RNP motif...		Lus10019147 [exp]	16.6	0.8865
AT5G13780			Acyl-CoA N-acyltransferases (N...		Lus10016378 [exp]	26.4	0.8744
AT2G15430		NRPE3A, NRPD3, ...	DNA-directed RNA polymerase fa...		Lus10002823 [exp]	34.8	0.8632
AT5G14530			Transducin/WD40 repeat-like su...		Lus10014558 [exp]	37.5	0.8574
AT3G57150		ATNAP57, ATCBF5...	homologue of NAP57 (.1)		Lus10023565 [exp]	37.5	0.8733
AT5G64670			Ribosomal protein L18e/L15 sup...		Lus10023078 [exp]	38.8	0.8679
AT2G44065			Ribosomal protein L2 family (....		Lus10001572 [exp]	39.8	0.8642
AT4G00930		CIP4.1	COP1-interacting protein 4.1 (...		Lus10011397 [exp]	54.6	0.8543

Compare expression of checked genes

Lus10026772 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.