Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025553 [exp] 130 / 1e-36 AT1G70250 341 / 4e-108 receptor serine/threonine kinase, putative (.1) Lus10025547 [exp] 102 / 6e-27 AT1G66920 345 / 2e-111 Protein kinase superfamily protein (.1.2) Lus10026761 [exp] 97 / 9e-25 AT1G67000 334 / 4e-107 Protein kinase superfamily protein (.1) Lus10014923 [exp] 69 / 6e-15 AT1G67000 335 / 2e-107 Protein kinase superfamily protein (.1) Lus10025491 [exp] 62 / 2e-12 AT5G53110 80 / 2e-16 RING/U-box superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G035500 [exp] 79 / 1e-18 AT1G66920 336 / 2e-107 Protein kinase superfamily protein (.1.2) Potri.007G125100 [exp] 74 / 1e-16 AT1G66920 347 / 2e-113 Protein kinase superfamily protein (.1.2) Potri.007G125900 [exp] 74 / 1e-16 AT1G66920 0 / 1 Protein kinase superfamily protein (.1.2) Potri.007G125600 [exp] 73 / 1e-16 AT5G38260 357 / 3e-115 Protein kinase superfamily protein (.1) Potri.007G126200 [exp] 73 / 2e-16 AT1G66920 333 / 3e-107 Protein kinase superfamily protein (.1.2) Potri.015G018101 [exp] 67 / 3e-14 AT1G66910 125 / 1e-31 Protein kinase superfamily protein (.1) Potri.015G018200 [exp] 67 / 4e-14 AT1G66920 368 / 1e-119 Protein kinase superfamily protein (.1.2) Potri.015G018000 [exp] 64 / 4e-13 AT1G66920 355 / 2e-114 Protein kinase superfamily protein (.1.2) Potri.012G003000 [exp] 59 / 2e-11 AT1G66920 356 / 5e-115 Protein kinase superfamily protein (.1.2) Potri.012G003400 [exp] 59 / 2e-11 AT1G66920 238 / 2e-71 Protein kinase superfamily protein (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10027011 pacid=23151617 polypeptide=Lus10027011 locus=Lus10027011.g ID=Lus10027011.BGIv1.0 annot-version=v1.0 ATGGCGGGGAGGTTTCAGACTTACAGTTTCTTTGACTGTCCGAAGCTGACGCATATCAGTCAAACGTTGGCGTCGGTGCCTTGCCTTGGAATTTCTCCTT TAAAGAAGGCACTGATAGCAGGAGTGGTTCTGGGTTCACTTCTCATTGTGGCATCAACGTATGCACACTACCGTGCATACAGATTCGACAGAAAGGAAAA GGAATACCGACTTAAGATCGAGAAGTTCTTGGACGATTACAAGGCACTCAAGCCTACACGATTCTCCTATGCAGATATAAAGAGAATAACGAACTAG
AA sequence Show only first row Show all	>Lus10027011 pacid=23151617 polypeptide=Lus10027011 locus=Lus10027011.g ID=Lus10027011.BGIv1.0 annot-version=v1.0 MAGRFQTYSFFDCPKLTHISQTLASVPCLGISPLKKALIAGVVLGSLLIVASTYAHYRAYRFDRKEKEYRLKIEKFLDDYKALKPTRFSYADIKRITN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10027011 [exp]	0	1
AT2G42710			Ribosomal protein L1p/L10e fam...		Lus10004691 [exp]	8.9	0.8777
AT3G54670		ATSMC1, TTN8	TITAN8, STRUCTURAL MAINTENANCE...		Lus10013581 [exp]	12.7	0.8725
					Lus10039025 [exp]	19.6	0.8634
AT1G11340			S-locus lectin protein kinase ...		Lus10025512 [exp]	19.7	0.8628
AT3G14740			RING/FYVE/PHD zinc finger supe...		Lus10042494 [exp]	22.4	0.8508
AT4G12300		CYP706A4	"cytochrome P450, family 706, ...		Lus10035196 [exp]	24.5	0.8629
AT3G66654			Cyclophilin-like peptidyl-prol...		Lus10004174 [exp]	26.9	0.8469
AT3G54070			Ankyrin repeat family protein ...		Lus10038357 [exp]	32.7	0.8439
AT5G07950			unknown protein		Lus10021622 [exp]	40.0	0.8506
AT2G41510		ATCKX1, CKX1	cytokinin oxidase/dehydrogenas...		Lus10042035 [exp]	48.6	0.8290

Compare expression of checked genes

Lus10027011 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.