Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G43795 45 / 2e-06 unknown protein AT3G59800 39 / 0.0002 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008338 [exp] 58 / 5e-11 AT3G59800 158 / 3e-49 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G010100 [exp] 54 / 1e-09 AT3G59800 147 / 4e-45 unknown protein Potri.007G139900 [exp] 50 / 2e-08 AT3G59800 150 / 6e-46 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10027090 pacid=23151614 polypeptide=Lus10027090 locus=Lus10027090.g ID=Lus10027090.BGIv1.0 annot-version=v1.0 ATGATGCGTGAGTACAGAGCCCAGCTGGATGCTGAAAGGGCGCACAAACTTGCTCATGGAAGGAACCATTCCAGTGTCAAGTCTAGCAATAAAAGAGATA AGAAGGAAAAAGATTCAAAGAAACAGCGCGGAAAAAAGAGAAAGCACTCCAGGCGCCGGTCTCCAGATTCCAGTTCGATGAGCTCATCATCCTCAGACGA ATCAAGTAGCGACGACGATGAGAGGGAGTCAAAGAGGTCAAAATCAAGGAGTAGTAAGAACAGAAAGAAGGAAAAACGTCACAGGTCGAGAAGCAAGCGT TCCACTGCAGACAATGAAGATGGCGATGGCCCTGTTCCACTTTCCAGATTCTTTGGGAACGTGAAGAGCTAG
AA sequence Show only first row Show all	>Lus10027090 pacid=23151614 polypeptide=Lus10027090 locus=Lus10027090.g ID=Lus10027090.BGIv1.0 annot-version=v1.0 MMREYRAQLDAERAHKLAHGRNHSSVKSSNKRDKKEKDSKKQRGKKRKHSRRRSPDSSSMSSSSSDESSSDDDERESKRSKSRSSKNRKKEKRHRSRSKR STADNEDGDGPVPLSRFFGNVKS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G43795			unknown protein		Lus10027090 [exp]	0	1
AT4G11080		3xHMG-box1	3xHigh Mobility Group-box1, HM...		Lus10023091 [exp]	20.1	0.8094
AT5G41685			Mitochondrial outer membrane t...		Lus10040758 [exp]	22.1	0.8038
AT5G53650			unknown protein		Lus10008848 [exp]	22.1	0.8049
AT5G14440			Surfeit locus protein 2 (SURF2...		Lus10022288 [exp]	26.3	0.8036
AT3G07590			Small nuclear ribonucleoprotei...		Lus10003727 [exp]	45.1	0.7955
AT3G13780			SMAD/FHA domain-containing pro...		Lus10015611 [exp]	50.3	0.7783
AT5G22320			Leucine-rich repeat (LRR) fami...		Lus10013308 [exp]	53.4	0.7886
AT3G13780			SMAD/FHA domain-containing pro...		Lus10037628 [exp]	56.0	0.7721
AT3G07590			Small nuclear ribonucleoprotei...		Lus10028022 [exp]	64.4	0.7816
AT5G45190			Cyclin family protein (.1.2)		Lus10036192 [exp]	68.7	0.7667

Compare expression of checked genes

Lus10027090 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.