Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52790 98 / 2e-27 peptidoglycan-binding LysM domain-containing protein (.1) AT5G62150 97 / 5e-27 peptidoglycan-binding LysM domain-containing protein (.1) AT4G25433 94 / 9e-26 peptidoglycan-binding LysM domain-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031662 [exp] 159 / 3e-51 AT3G52790 112 / 4e-33 peptidoglycan-binding LysM domain-containing protein (.1) Lus10015011 [exp] 101 / 5e-29 AT5G62150 107 / 5e-32 peptidoglycan-binding LysM domain-containing protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G077900 [exp] 125 / 4e-38 AT4G25433 108 / 7e-32 peptidoglycan-binding LysM domain-containing protein (.1) Potri.015G137500 [exp] 115 / 2e-34 AT4G25433 113 / 7e-34 peptidoglycan-binding LysM domain-containing protein (.1) Potri.002G152600 [exp] 112 / 4e-33 AT5G62150 100 / 1e-28 peptidoglycan-binding LysM domain-containing protein (.1) Potri.010G231000 [exp] 111 / 9e-33 AT3G52790 119 / 3e-36 peptidoglycan-binding LysM domain-containing protein (.1) Potri.012G135100 [exp] 111 / 1e-32 AT4G25433 108 / 5e-32 peptidoglycan-binding LysM domain-containing protein (.1) Potri.008G030200 [exp] 107 / 2e-31 AT3G52790 114 / 1e-34 peptidoglycan-binding LysM domain-containing protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0187 [flax] [poplar] LysM PF01476 [flax] [poplar] LysM LysM domain
Representative CDS sequence Show only first row Show all	>Lus10027407 pacid=23144467 polypeptide=Lus10027407 locus=Lus10027407.g ID=Lus10027407.BGIv1.0 annot-version=v1.0 ATGAATTCTCCGACCACCTTCCGCCGGACAAGATCCAACAACACCAACAATAGCTTAGCGGTAGCTGACGCAGCATCGTGGTACTGCGCCACCATCCTGC TCGGGCTCATCCTGATGGCGTCCATCATGGAGAGCTCGTCGGAGTCGGACGACTCCTCGGCGGCGACGGTGAAAGGAAATCAGCTCCTCAGCGATCGGCC GTGCGACGAGATATACGTGGTTAGAGAAGGGGAGACGCTGAACACGATAAGCGAGAAGTGTGGCGACCCGTACATCGTGGAGGAGAACCCGCATATCCAC GACCCGGATGACGTGTTTCCGGGTCTCGTCATCAAAATCACCCCTTCTTCTACTTCATCTTCTTCTTCCGGCAATATGAGAAATTGA
AA sequence Show only first row Show all	>Lus10027407 pacid=23144467 polypeptide=Lus10027407 locus=Lus10027407.g ID=Lus10027407.BGIv1.0 annot-version=v1.0 MNSPTTFRRTRSNNTNNSLAVADAASWYCATILLGLILMASIMESSSESDDSSAATVKGNQLLSDRPCDEIYVVREGETLNTISEKCGDPYIVEENPHIH DPDDVFPGLVIKITPSSTSSSSSGNMRN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G52790			peptidoglycan-binding LysM dom...		Lus10027407 [exp]	0	1
AT4G33550			Bifunctional inhibitor/lipid-t...		Lus10019029 [exp]	1.0	0.9943
AT1G08170			Histone superfamily protein (....		Lus10041351 [exp]	2.0	0.9891
AT5G17820			Peroxidase superfamily protein...		Lus10013631 [exp]	2.2	0.9700
AT3G56850	bZIP	DPBF3, AREB3	ABA-responsive element binding...		Lus10028888 [exp]	2.4	0.9794
AT4G21200		ATGA2OX8	ARABIDOPSIS THALIANA GIBBERELL...		Lus10007640 [exp]	2.8	0.9719
AT3G53720		ATCHX20	cation/H+ exchanger 20, cation...		Lus10025325 [exp]	4.2	0.9369
AT5G24620			Pathogenesis-related thaumatin...		Lus10023896 [exp]	4.9	0.9522
AT3G18280			Bifunctional inhibitor/lipid-t...		Lus10013030 [exp]	5.5	0.9462
AT1G22710		SUT1, ATSUC2, S...	SUCROSE TRANSPORTER 1, ARABIDO...		Lus10009428 [exp]	6.9	0.9540
AT2G46890			Protein of unknown function (D...		Lus10010291 [exp]	7.1	0.9401

Compare expression of checked genes

Lus10027407 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.