Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G64920 88 / 3e-21 UDP-Glycosyltransferase superfamily protein (.1) AT5G53990 86 / 2e-20 UDP-Glycosyltransferase superfamily protein (.1) AT1G64910 86 / 2e-20 UDP-Glycosyltransferase superfamily protein (.1) AT4G09500 83 / 2e-19 UDP-Glycosyltransferase superfamily protein (.1.2) AT2G22930 82 / 2e-19 UDP-Glycosyltransferase superfamily protein (.1) AT4G27570 81 / 6e-19 UDP-Glycosyltransferase superfamily protein (.1) AT5G54010 78 / 1e-17 UDP-Glycosyltransferase superfamily protein (.1) AT4G27560 76 / 4e-17 UDP-Glycosyltransferase superfamily protein (.1) AT3G29630 76 / 5e-17 UDP-Glycosyltransferase superfamily protein (.1) AT1G50580 71 / 2e-15 UDP-Glycosyltransferase superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10013368 [exp] 106 / 2e-30 AT4G27570 105 / 6e-34 UDP-Glycosyltransferase superfamily protein (.1) Lus10013337 [exp] 99 / 3e-25 AT5G54010 452 / 1e-156 UDP-Glycosyltransferase superfamily protein (.1) Lus10039236 [exp] 90 / 8e-25 AT4G27570 61 / 7e-13 UDP-Glycosyltransferase superfamily protein (.1) Lus10000643 [exp] 67 / 8e-14 AT1G69170 192 / 4e-55 Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (.1) Lus10008742 [exp] 47 / 8e-07 AT2G43840 478 / 6e-167 UDP-glycosyltransferase 74 F1 (.1.2) Lus10003805 [exp] 40 / 0.0002 AT1G07250 332 / 5e-109 UDP-glucosyl transferase 71C4 (.1) Lus10010476 [exp] 40 / 0.0002 AT1G07250 342 / 7e-113 UDP-glucosyl transferase 71C4 (.1) Lus10042260 [exp] 40 / 0.0002 AT2G30140 410 / 3e-139 UDP-Glycosyltransferase superfamily protein (.1.2) Lus10009412 [exp] 40 / 0.0002 AT2G43820 474 / 1e-165 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G097900 [exp] 81 / 6e-19 AT5G54010 498 / 1e-174 UDP-Glycosyltransferase superfamily protein (.1) Potri.011G061000 [exp] 74 / 4e-16 AT5G54010 468 / 6e-163 UDP-Glycosyltransferase superfamily protein (.1) Potri.006G179700 [exp] 57 / 2e-10 AT5G54010 349 / 2e-116 UDP-Glycosyltransferase superfamily protein (.1) Potri.017G032733 [exp] 41 / 0.0001 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032700 [exp] 41 / 0.0001 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032500 [exp] 40 / 0.0001 AT1G05680 446 / 1e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032300 [exp] 39 / 0.0003 AT1G05675 465 / 6e-162 UDP-Glycosyltransferase superfamily protein (.1) Potri.002G168600 [exp] 39 / 0.0003 AT4G01070 595 / 0.0 UDP-GLUCOSE-DEPENDENT GLUCOSYLTRANSFERASE 72 B1, UDP-Glycosyltransferase superfamily protein (.1.2) Potri.015G071900 [exp] 39 / 0.0003 AT1G24100 427 / 5e-147 UDP-glucosyl transferase 74B1 (.1) Potri.017G041900 [exp] 0 / 1 AT5G54010 348 / 1e-116 UDP-Glycosyltransferase superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10027483 pacid=23144496 polypeptide=Lus10027483 locus=Lus10027483.g ID=Lus10027483.BGIv1.0 annot-version=v1.0 ATGGGTTCAACAGCCGCAAATTCTGGACCACCCATCAGTGGGTTGCTTCGTGAGTCATTGCGGGTACGGTTCGATGTGGTAGGCTCTGTTGAGCGACTGT CAGATACTGTTGGTCCCAACATAACCGATCAGATCGTGTCGACGATTTTCATGGTGAAGGAGCTGGAGGTGGCCTTGGAAGTCGACAAGGACGAGAATGG GTGGATCAGCAAGGAGGAGGTTTGCAGAGCCATTGAAGCTGTGATGGATGAGGAGAGTGTAGTCGGCAAGGAAGTGAGGAGGAACCATTTGAAGTTGAGG GAGGTTTTGGGAGATGGTCGTCTTATGGATAAGTATGTTGATGATTTTGTTGACCAGCTTCGTACTCTCGTTCTTCCTTGTGAAGCCTGA
AA sequence Show only first row Show all	>Lus10027483 pacid=23144496 polypeptide=Lus10027483 locus=Lus10027483.g ID=Lus10027483.BGIv1.0 annot-version=v1.0 MGSTAANSGPPISGLLRESLRVRFDVVGSVERLSDTVGPNITDQIVSTIFMVKELEVALEVDKDENGWISKEEVCRAIEAVMDEESVVGKEVRRNHLKLR EVLGDGRLMDKYVDDFVDQLRTLVLPCEA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G27570			UDP-Glycosyltransferase superf...		Lus10027483 [exp]	0	1
AT2G25010			Aminotransferase-like, plant m...		Lus10032693 [exp]	5.1	0.8176
AT4G26590		ATOPT5	ARABIDOPSIS THALIANA OLIGOPEPT...		Lus10031978 [exp]	7.2	0.7871
					Lus10022658 [exp]	7.3	0.6202
AT2G30710			Ypt/Rab-GAP domain of gyp1p su...		Lus10025585 [exp]	10.5	0.7154
AT2G46150			Late embryogenesis abundant (L...		Lus10039664 [exp]	11.3	0.7133
AT1G28300	B3	LEC2	LEAFY COTYLEDON 2, AP2/B3-like...		Lus10014005 [exp]	18.9	0.6187
AT3G02960			Heavy metal transport/detoxifi...		Lus10015762 [exp]	20.2	0.6187
AT3G60730			Plant invertase/pectin methyle...		Lus10015877 [exp]	21.4	0.6187
AT1G66350	GRAS	RGL1	RGA-like 1 (.1)		Lus10016888 [exp]	22.6	0.6187
AT5G05070			DHHC-type zinc finger family p...		Lus10027274 [exp]	23.7	0.6187

Compare expression of checked genes

Lus10027483 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.