Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012066 [exp] 47 / 4e-08 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10027919 pacid=23156882 polypeptide=Lus10027919 locus=Lus10027919.g ID=Lus10027919.BGIv1.0 annot-version=v1.0 ATGGCGGATCACATTAGTACCAGAGCAAATGTTCCGGTGTGTGTTATGATGATAAGCTTGGTTCTGCTGATGATTGCCTTCTCGTCTGAATCTTCGATGG CTCGGCCGCTCGTATATCTTCCGAAATCCGGTGTGAAGATGAATCATGAAGATGGTCTCTTCCAAGAATCGAAACTTACTGTGACGGGAAGTTCTTCACG TCCAAGTCGTCATGGGAATACCCGACCCGGTAGTCCCAAAGTTAATTAG
AA sequence Show only first row Show all	>Lus10027919 pacid=23156882 polypeptide=Lus10027919 locus=Lus10027919.g ID=Lus10027919.BGIv1.0 annot-version=v1.0 MADHISTRANVPVCVMMISLVLLMIAFSSESSMARPLVYLPKSGVKMNHEDGLFQESKLTVTGSSSRPSRHGNTRPGSPKVN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10027919 [exp]	0	1
AT3G09220		LAC7	laccase 7 (.1)		Lus10027747 [exp]	1.7	0.9841
AT5G65380			MATE efflux family protein (.1...		Lus10012741 [exp]	2.8	0.9770
AT4G11410			NAD(P)-binding Rossmann-fold s...		Lus10035480 [exp]	4.6	0.9777
AT4G11410			NAD(P)-binding Rossmann-fold s...		Lus10035479 [exp]	5.5	0.9769
AT5G12340			unknown protein		Lus10036031 [exp]	5.7	0.9704
AT2G14095			unknown protein		Lus10001300 [exp]	5.7	0.9764
AT1G78780			pathogenesis-related family pr...		Lus10029763 [exp]	6.2	0.9810
					Lus10020455 [exp]	7.7	0.9762
AT4G35180		LHT7	LYS/HIS transporter 7 (.1)		Lus10022642 [exp]	7.7	0.9803
AT3G05200		ATL6	RING/U-box superfamily protein...		Lus10004460 [exp]	8.1	0.9786

Compare expression of checked genes

Lus10027919 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.