Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G22140 44 / 2e-07 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025627 [exp] 97 / 6e-28 AT1G22140 81 / 4e-22 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G167200 [exp] 62 / 4e-14 AT1G22140 60 / 9e-14 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10028077 pacid=23181216 polypeptide=Lus10028077 locus=Lus10028077.g ID=Lus10028077.BGIv1.0 annot-version=v1.0 ATGGGAGAGCAACCAAAGCATGTAACGGAGCGGCCAACAGGAAACACCATGACTCATGCTCAGTTCCTCTCCTGGAAGCGGCGGAAGAGCTCTATCAAAG TCGGTATTGAAGCAGTGCTTATTGAGTCTCTAATAACATGTCTATCAACTGTATTAAAGGATGAAGATGCCTTGGCTACAAGAGAAGCAGCGGCTAGGAA GCGTGCGGAAGATATAGCTGCAGGAATAGTGCAAAGGAATGGACGTGAACTTTTCATCGATGAACCTTGGGTCTTCGATAACACTCAATACTAG
AA sequence Show only first row Show all	>Lus10028077 pacid=23181216 polypeptide=Lus10028077 locus=Lus10028077.g ID=Lus10028077.BGIv1.0 annot-version=v1.0 MGEQPKHVTERPTGNTMTHAQFLSWKRRKSSIKVGIEAVLIESLITCLSTVLKDEDALATREAAARKRAEDIAAGIVQRNGRELFIDEPWVFDNTQY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G22140			unknown protein		Lus10028077 [exp]	0	1
AT3G25570			Adenosylmethionine decarboxyla...		Lus10034412 [exp]	5.6	0.7495
AT5G09225			unknown protein		Lus10020870 [exp]	10.7	0.7326
AT4G29660		EMB2752	embryo defective 2752 (.1)		Lus10032908 [exp]	12.2	0.6748
AT5G39590			TLD-domain containing nucleola...		Lus10012406 [exp]	14.7	0.7111
AT2G38280		ATAMPD, FAC1	EMBRYONIC FACTOR1, ADENOSINE 5...		Lus10005043 [exp]	19.0	0.7080
AT1G73320			S-adenosyl-L-methionine-depend...		Lus10031894 [exp]	22.5	0.6738
AT4G03140			NAD(P)-binding Rossmann-fold s...		Lus10005927 [exp]	34.0	0.7051
AT3G11591			unknown protein		Lus10016986 [exp]	38.5	0.7087
AT3G05675			BTB/POZ domain-containing prot...		Lus10021269 [exp]	40.2	0.7063
AT3G57000			nucleolar essential protein-re...		Lus10028959 [exp]	40.7	0.6880

Compare expression of checked genes

Lus10028077 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.