Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G57260 125 / 3e-35 CYP71B10 "cytochrome P450, family 71, subfamily B, polypeptide 10", cytochrome P450, family 71, subfamily B, polypeptide 10 (.1) AT3G26270 121 / 8e-34 CYP71B25 "cytochrome P450, family 71, subfamily B, polypeptide 25", cytochrome P450, family 71, subfamily B, polypeptide 25 (.1) AT3G26230 120 / 1e-33 CYP71B24 "cytochrome P450, family 71, subfamily B, polypeptide 24", cytochrome P450, family 71, subfamily B, polypeptide 24 (.1) AT3G26280 116 / 4e-32 CYP71B4 "cytochrome P450, family 71, subfamily B, polypeptide 4", cytochrome P450, family 71, subfamily B, polypeptide 4 (.1) AT4G22710 116 / 8e-32 CYP706A2 "cytochrome P450, family 706, subfamily A, polypeptide 2", cytochrome P450, family 706, subfamily A, polypeptide 2 (.1) AT3G26210 115 / 8e-32 CYP71B23 "cytochrome P450, family 71, subfamily B, polypeptide 23", cytochrome P450, family 71, subfamily B, polypeptide 23 (.1) AT4G22690 116 / 1e-31 CYP706A1 "cytochrome P450, family 706, subfamily A, polypeptide 1", cytochrome P450, family 706, subfamily A, polypeptide 1 (.1) AT2G45580 115 / 1e-31 CYP76C3 "cytochrome P450, family 76, subfamily C, polypeptide 3", cytochrome P450, family 76, subfamily C, polypeptide 3 (.1) AT3G26830 114 / 2e-31 CYP71B15, PAD3 PHYTOALEXIN DEFICIENT 3, Cytochrome P450 superfamily protein (.1) AT3G26300 114 / 3e-31 CYP71B34 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042815 [exp] 174 / 1e-53 AT1G13110 396 / 3e-133 "cytochrome P450, family 71 subfamily B, polypeptide 7", cytochrome P450, family 71 subfamily B, polypeptide 7 (.1) Lus10012767 [exp] 137 / 1e-39 AT3G26210 386 / 1e-129 "cytochrome P450, family 71, subfamily B, polypeptide 23", cytochrome P450, family 71, subfamily B, polypeptide 23 (.1) Lus10030708 [exp] 132 / 1e-37 AT3G26210 390 / 6e-131 "cytochrome P450, family 71, subfamily B, polypeptide 23", cytochrome P450, family 71, subfamily B, polypeptide 23 (.1) Lus10013194 [exp] 130 / 5e-37 AT5G25120 387 / 9e-130 "ytochrome p450, family 71, subfamily B, polypeptide 11", ytochrome p450, family 71, subfamily B, polypeptide 11 (.1) Lus10030924 [exp] 129 / 2e-36 AT3G26300 391 / 2e-131 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Lus10016601 [exp] 126 / 1e-35 AT3G26320 402 / 6e-136 "cytochrome P450, family 71, subfamily B, polypeptide 36", cytochrome P450, family 71, subfamily B, polypeptide 36 (.1) Lus10018263 [exp] 126 / 2e-35 AT5G25140 393 / 5e-132 "cytochrome P450, family 71, subfamily B, polypeptide 13", cytochrome P450, family 71, subfamily B, polypeptide 13 (.1) Lus10002885 [exp] 124 / 1e-34 AT3G48280 396 / 2e-133 "cytochrome P450, family 71, subfamily A, polypeptide 25", cytochrome P450, family 71, subfamily A, polypeptide 25 (.1) Lus10034397 [exp] 120 / 1e-34 AT3G26230 249 / 2e-79 "cytochrome P450, family 71, subfamily B, polypeptide 24", cytochrome P450, family 71, subfamily B, polypeptide 24 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G085000 [exp] 128 / 3e-36 AT5G07990 402 / 5e-135 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.011G131001 [exp] 122 / 9e-36 AT3G26230 230 / 4e-72 "cytochrome P450, family 71, subfamily B, polypeptide 24", cytochrome P450, family 71, subfamily B, polypeptide 24 (.1) Potri.012G090000 [exp] 125 / 2e-35 AT3G26330 433 / 5e-148 "cytochrome P450, family 71, subfamily B, polypeptide 37", cytochrome P450, family 71, subfamily B, polypeptide 37 (.1) Potri.015G086000 [exp] 125 / 2e-35 AT1G13080 434 / 2e-148 "cytochrome P450, family 71, subfamily B, polypeptide 2", cytochrome P450, family 71, subfamily B, polypeptide 2 (.1.2) Potri.012G089900 [exp] 125 / 2e-35 AT3G48280 429 / 1e-146 "cytochrome P450, family 71, subfamily A, polypeptide 25", cytochrome P450, family 71, subfamily A, polypeptide 25 (.1) Potri.007G084700 [exp] 125 / 2e-35 AT5G07990 397 / 5e-134 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.007G084200 [exp] 123 / 1e-34 AT3G26300 385 / 1e-129 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Potri.001G113900 [exp] 122 / 4e-34 AT2G45550 496 / 1e-172 "cytochrome P450, family 76, subfamily C, polypeptide 4", cytochrome P450, family 76, subfamily C, polypeptide 4 (.1) Potri.003G118200 [exp] 117 / 3e-32 AT2G45550 438 / 9e-150 "cytochrome P450, family 76, subfamily C, polypeptide 4", cytochrome P450, family 76, subfamily C, polypeptide 4 (.1) Potri.011G130850 [exp] 117 / 3e-32 AT3G26300 361 / 5e-120 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00067 [flax] [poplar] p450 Cytochrome P450
Representative CDS sequence Show only first row Show all	>Lus10028112 pacid=23166575 polypeptide=Lus10028112 locus=Lus10028112.g ID=Lus10028112.BGIv1.0 annot-version=v1.0 ATGCCAGTCATCAAAGAGGCCCTAAGGATGCACCCGGCAGGTCCTCTGCTCGTTCCGAGAGAAAGTATTGAAGACGTGGTTATCAATGGATATACGATCC CTACCGGAACTAAAGTCATGATTAATGTCTGGGCTATCGGGAGAGACCCGAAATACTGGGATGACCCGAAGACTTTCTATCCGGAGAAATTTCTTGATTG CTCGACGGACTTCAAGGGGAGAGACTTTGAGTTCATTCCGTTTGGTACTGGGAAAAGGATGGCTCTAAAATGGCTTTCGGGGTGGCAATCGTTCCACTAG
AA sequence Show only first row Show all	>Lus10028112 pacid=23166575 polypeptide=Lus10028112 locus=Lus10028112.g ID=Lus10028112.BGIv1.0 annot-version=v1.0 MPVIKEALRMHPAGPLLVPRESIEDVVINGYTIPTGTKVMINVWAIGRDPKYWDDPKTFYPEKFLDCSTDFKGRDFEFIPFGTGKRMALKWLSGWQSFH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G26270		CYP71B25	"cytochrome P450, family 71, s...		Lus10028112 [exp]	0	1
AT5G45110		ATNPR3, NPR3	NPR1-like protein 3 (.1)		Lus10038337 [exp]	7.2	0.8144
					Lus10015577 [exp]	15.8	0.7199
AT4G37850	bHLH	bHLH025	basic helix-loop-helix (bHLH) ...		Lus10019247 [exp]	16.7	0.7883
AT1G61110	NAC	ANAC025	NAC domain containing protein ...		Lus10026496 [exp]	17.4	0.7974
AT5G02800		CDL1	CDG1-like 1, Protein kinase su...		Lus10019897 [exp]	31.6	0.7799
AT3G21700		ATSGP2	Ras-related small GTP-binding ...		Lus10039670 [exp]	45.6	0.7771
AT4G35840			RING/U-box superfamily protein...		Lus10028406 [exp]	46.6	0.7656
					Lus10039764 [exp]	88.3	0.7217
AT1G30825		DIS2, ARPC2, AR...	DISTORTED TRICHOMES 2, ACTIN-R...		Lus10002867 [exp]	156.3	0.7197
AT4G32295			unknown protein		Lus10001504 [exp]	161.7	0.7166

Compare expression of checked genes

Lus10028112 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.