Lus10028155 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G17940 106 / 2e-29 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT1G80130 82 / 8e-20 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT5G20190 81 / 1e-19 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT4G32340 79 / 5e-19 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT1G04530 66 / 5e-14 TPR4 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT1G07280 59 / 4e-11 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2), Tetratricopeptide repeat (TPR)-like superfamily protein (.3)
AT2G29670 53 / 3e-09 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT3G47080 44 / 3e-06 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10030103 96 / 5e-25 AT5G20190 179 / 1e-54 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10002166 94 / 4e-24 AT5G20190 192 / 8e-60 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10002013 83 / 5e-20 AT4G32340 152 / 5e-45 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10024949 80 / 1e-18 AT4G17940 125 / 8e-33 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10000257 79 / 4e-18 AT1G04530 179 / 3e-52 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10014468 78 / 9e-18 AT1G04530 177 / 1e-51 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10023721 77 / 1e-17 AT1G04530 171 / 4e-49 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10022877 76 / 2e-17 AT4G17940 121 / 5e-32 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10043266 68 / 9e-15 AT5G20190 162 / 1e-48 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.001G140500 106 / 2e-29 AT4G17940 196 / 9e-62 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.018G130100 84 / 2e-20 AT5G20190 180 / 5e-55 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.006G254300 83 / 2e-20 AT4G32340 157 / 2e-47 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.006G068200 83 / 3e-20 AT5G20190 167 / 6e-50 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.008G172200 84 / 4e-20 AT1G04530 137 / 1e-36 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.018G130300 82 / 1e-19 AT5G20190 166 / 2e-49 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.002G256900 81 / 5e-19 AT4G17940 125 / 2e-33 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.010G065400 81 / 6e-19 AT1G04530 160 / 5e-46 tetratricopeptide repeat 4, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.001G250100 61 / 8e-12 AT2G29670 499 / 5e-172 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.009G044200 59 / 3e-11 AT2G29670 484 / 5e-166 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
PFAM info
Representative CDS sequence
>Lus10028155 pacid=23166536 polypeptide=Lus10028155 locus=Lus10028155.g ID=Lus10028155.BGIv1.0 annot-version=v1.0
ATGCATCTGATAGTCGATCCAATGGTGGAAGGGGACGTGAAAAGAGCGGAGGAATACTACGGGAGGGCGCTGCTGGAGAGTCCAGGGGATGGTGAGGCGT
TGTCTCTTTATGCAAATCTAATATGGAACAATTACAGAGACCAGCATCGCGCTTTTACTTACTTCCATCACGCTGCTTCCGCCTCCCCAAATGACTGCAT
GGTTATGGGATCCTACGCGCATTTTATGTGGGCAACGGAAGCCGAAGAAGAAGCCAACAAAGACAAAGGCGGCGGAGGCGAAGTCCCGCCACCCGCAATG
CCGCTGCCGTCGAGGCCACCGGCCATGGTTCCTGCTTTTTAA
AA sequence
>Lus10028155 pacid=23166536 polypeptide=Lus10028155 locus=Lus10028155.g ID=Lus10028155.BGIv1.0 annot-version=v1.0
MHLIVDPMVEGDVKRAEEYYGRALLESPGDGEALSLYANLIWNNYRDQHRAFTYFHHAASASPNDCMVMGSYAHFMWATEAEEEANKDKGGGGEVPPPAM
PLPSRPPAMVPAF

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G17940 Tetratricopeptide repeat (TPR)... Lus10028155 0 1

Lus10028155 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.