Lus10028225 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G49665 64 / 4e-13 Zinc finger (C3HC4-type RING finger) family protein (.1)
AT4G37890 54 / 1e-09 EDA40 embryo sac development arrest 40, Zinc finger (C3HC4-type RING finger) family protein (.1), Zinc finger (C3HC4-type RING finger) family protein (.2)
AT2G22680 50 / 2e-08 WAVH1 WAV3 homolog 1, Zinc finger (C3HC4-type RING finger) family protein (.1)
AT5G65683 48 / 9e-08 WAVH2 WAV3 homolog 2, Zinc finger (C3HC4-type RING finger) family protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10042930 94 / 1e-23 AT5G49665 397 / 7e-129 Zinc finger (C3HC4-type RING finger) family protein (.1)
Lus10039635 57 / 6e-11 AT4G37890 290 / 1e-92 embryo sac development arrest 40, Zinc finger (C3HC4-type RING finger) family protein (.1), Zinc finger (C3HC4-type RING finger) family protein (.2)
Lus10003485 53 / 3e-09 AT2G22680 522 / 9e-177 WAV3 homolog 1, Zinc finger (C3HC4-type RING finger) family protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G107902 78 / 4e-18 AT5G49665 675 / 0.0 Zinc finger (C3HC4-type RING finger) family protein (.1)
PFAM info
Representative CDS sequence
>Lus10028225 pacid=23166554 polypeptide=Lus10028225 locus=Lus10028225.g ID=Lus10028225.BGIv1.0 annot-version=v1.0
ATGCAGTCGGAGTACGAAGGGGCGGAGGAGTACCGGAAGGTGGTGGAGGTGGAGCTAGCAGAGCTACACTGGAGGAAACAACAGGAGATAGAGGCGGGGG
CGATGATGATGCAACAGCAACGGAGGAGAGGAGGAGAGAGGGAAGCGGCGGTGGTGATGACTGACGAGAACGGGGAGCCGTTAACGCCGACATCGGCTTG
GAGAGCGGCTGAGAAGCTGGCTAAGATGGCTATGATGAAGAAGTCGATGAATAGAGTGAGCGATTTACACGGGTTTGAAAACGCGAGATTCTGA
AA sequence
>Lus10028225 pacid=23166554 polypeptide=Lus10028225 locus=Lus10028225.g ID=Lus10028225.BGIv1.0 annot-version=v1.0
MQSEYEGAEEYRKVVEVELAELHWRKQQEIEAGAMMMQQQRRRGGEREAAVVMTDENGEPLTPTSAWRAAEKLAKMAMMKKSMNRVSDLHGFENARF

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G49665 Zinc finger (C3HC4-type RING f... Lus10028225 0 1
AT2G36400 GRF ATGRF3 growth-regulating factor 3 (.1... Lus10014381 4.1 0.9260
AT2G21060 ATCSP4, ATGRP2B COLD SHOCK DOMAIN PROTEIN 4, g... Lus10034487 5.1 0.9196
AT2G33845 Nucleic acid-binding, OB-fold-... Lus10002172 6.7 0.8989
AT1G67120 ATPases;nucleotide binding;ATP... Lus10035904 8.5 0.9027
AT4G11080 3xHMG-box1 3xHigh Mobility Group-box1, HM... Lus10033951 8.7 0.9112
AT5G48480 Lactoylglutathione lyase / gly... Lus10009580 8.9 0.8970
AT2G36400 GRF ATGRF3 growth-regulating factor 3 (.1... Lus10014380 9.0 0.9142
AT3G45980 H2B, HTB9 HISTONE H2B, Histone superfami... Lus10005893 9.2 0.9098
AT1G72210 bHLH bHLH096 basic helix-loop-helix (bHLH) ... Lus10015902 10.9 0.9044
AT5G23570 SGS3, ATSGS3 SUPPRESSOR OF GENE SILENCING 3... Lus10004302 12.4 0.8756

Lus10028225 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.