Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G40130 134 / 1e-37 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1.2) AT2G29970 115 / 3e-30 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) AT1G07200 115 / 3e-30 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1.2) AT5G57710 72 / 4e-15 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) AT4G30350 67 / 3e-13 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) AT3G52490 64 / 4e-12 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) AT4G29920 58 / 4e-10 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) AT5G57130 57 / 8e-10 Clp amino terminal domain-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040206 [exp] 169 / 7e-49 AT2G40130 569 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1.2) Lus10038320 [exp] 114 / 6e-30 AT2G29970 696 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10019984 [exp] 74 / 2e-15 AT5G57710 912 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10015511 [exp] 71 / 2e-14 AT5G57710 899 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10021291 [exp] 65 / 1e-12 AT3G52490 690 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10023201 [exp] 65 / 2e-12 AT5G57710 404 / 1e-127 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10008970 [exp] 64 / 3e-12 AT3G52490 460 / 1e-147 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Lus10028849 [exp] 64 / 3e-12 AT3G52490 498 / 5e-165 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G188200 [exp] 147 / 2e-41 AT1G07200 624 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1.2) Potri.008G069100 [exp] 146 / 6e-41 AT2G29970 610 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.001G252500 [exp] 120 / 7e-32 AT2G29970 668 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.009G046700 [exp] 119 / 2e-31 AT2G29970 658 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.006G175200 [exp] 72 / 5e-15 AT5G57710 913 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.018G097300 [exp] 67 / 2e-13 AT5G57710 998 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.006G073800 [exp] 66 / 6e-13 AT4G29920 693 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.008G017600 [exp] 65 / 2e-12 AT3G52490 635 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.016G071800 [exp] 65 / 2e-12 AT3G52490 785 / 0.0 Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein (.1) Potri.018G140900 [exp] 64 / 3e-12 AT5G57130 751 / 0.0 Clp amino terminal domain-containing protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10028282 pacid=23166471 polypeptide=Lus10028282 locus=Lus10028282.g ID=Lus10028282.BGIv1.0 annot-version=v1.0 ATGCCTACGCCGGTGAGTACAGCCAGGCAATGCTTGACTCCGGAAGCTGCCCACGCGCTGGACGAGGCAGTGCGCGTGGCCAAGAAGAGGGGACACGGCC AAACGACGTCGCTACACGCCGTCTCCGCCCTCCTTTCCTTCCCTTCCTCCGCCCTCCGCGACGCCTGTACACGAGCTAGGAACTCTGCCTACTCCACGCG CCTTCAGTTCAAGGCGCTCGACCTCTGCCTCAGCGTCTCCCTCGACCGCGTCCCTTCAGCCGGCGACGGCGGCGGAGATTCATCGCCGCCGGTGGCGGCG GAGATTCCTCGCCGCCGGTTTCCAACTCGCTCATGGCGGCGATCAAGCGGTCTCAGGCGAACCAGAGGCGGCAGCCGGAGAGCTTCCATTTGTTCCACCA GTTTTCCTCTCAGAACATCAACTTCAATCAATTGGCGGCGGCGTCTTCACCATCTTCTCCTTCATCGTCCTCTTCTTCCGTTTCTTGCATCAGGGTGGAT CTAA
AA sequence Show only first row Show all	>Lus10028282 pacid=23166471 polypeptide=Lus10028282 locus=Lus10028282.g ID=Lus10028282.BGIv1.0 annot-version=v1.0 MPTPVSTARQCLTPEAAHALDEAVRVAKKRGHGQTTSLHAVSALLSFPSSALRDACTRARNSAYSTRLQFKALDLCLSVSLDRVPSAGDGGGDSSPPVAA EIPRRRFPTRSWRRSSGLRRTRGGSRRASICSTSFPLRTSTSINWRRRLHHLLLHRPLLPFLASGWI

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G40130			Double Clp-N motif-containing ...		Lus10028282 [exp]	0	1
AT2G40130			Double Clp-N motif-containing ...		Lus10040206 [exp]	1.0	0.9355
AT1G17420		ATLOX3, LOX3	Arabidopsis thaliana lipoxygen...		Lus10015666 [exp]	1.4	0.9224
AT1G17820			Putative integral membrane pro...		Lus10040647 [exp]	1.7	0.9098
AT2G40070			unknown protein		Lus10011374 [exp]	2.2	0.9069
AT4G21760		BGLU47	beta-glucosidase 47 (.1)		Lus10018354 [exp]	2.6	0.9053
AT3G51150			ATP binding microtubule motor ...		Lus10025969 [exp]	3.5	0.9076
					Lus10008674 [exp]	6.3	0.8950
AT4G03020			transducin family protein / WD...		Lus10033996 [exp]	6.7	0.8191
AT4G25420		AT2301, GA5, AT...	GA REQUIRING 5, ARABIDOPSIS TH...		Lus10015016 [exp]	7.2	0.8682
AT1G07200			Double Clp-N motif-containing ...		Lus10028281 [exp]	7.7	0.9065

Compare expression of checked genes

Lus10028282 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.