Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10028607 pacid=23164515 polypeptide=Lus10028607 locus=Lus10028607.g ID=Lus10028607.BGIv1.0 annot-version=v1.0 ATGGCTATTTCCAAGAGAGACCAACACAATCATAATCTCTCAACTGGTATGTCCATCATCATCCTTGTATTACTACTCTCCTCTCGAGTCTCGTACGCCA CCCCCTCAGATAGTTCGATTGAAAGCCATCAGAATGCGATTGGTGGACCTGTTCTTGACCAGCAACGACCAACCATCGGTGGGAGGAAGTTCATTGTGGA AAGAATGACAAAGGTAGACACCGATGACTACCCTCCTGCCAGGGTCAAGCCGCCGATGCCTACTCCGTGTTGTTGA
AA sequence Show only first row Show all	>Lus10028607 pacid=23164515 polypeptide=Lus10028607 locus=Lus10028607.g ID=Lus10028607.BGIv1.0 annot-version=v1.0 MAISKRDQHNHNLSTGMSIIILVLLLSSRVSYATPSDSSIESHQNAIGGPVLDQQRPTIGGRKFIVERMTKVDTDDYPPARVKPPMPTPCC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10028607 [exp]	0	1
AT5G25840			Protein of unknown function (D...		Lus10006044 [exp]	2.0	0.9170
AT1G33760	AP2_ERF		Integrase-type DNA-binding sup...		Lus10002953 [exp]	2.0	0.9142
AT5G28840		GME	"GDP-D-mannose 3',5'-epimerase...		Lus10020247 [exp]	3.2	0.9127
AT1G33760	AP2_ERF		Integrase-type DNA-binding sup...		Lus10003513 [exp]	3.5	0.9127
AT5G06300		LOG7	LONELY GUY 7, Putative lysine ...		Lus10024328 [exp]	5.5	0.8764
AT5G40780		LHT1, LTH1	lysine histidine transporter 1...		Lus10032074 [exp]	5.7	0.9131
AT2G24400			SAUR-like auxin-responsive pro...		Lus10033348 [exp]	8.4	0.9036
AT5G25840			Protein of unknown function (D...		Lus10000571 [exp]	8.5	0.9100
AT4G17970		ATALMT12, ALMT1...	"aluminum-activated, malate tr...		Lus10030975 [exp]	8.9	0.9012
AT3G09450			unknown protein		Lus10025334 [exp]	10.2	0.8611

Compare expression of checked genes

Lus10028607 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.