Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G02360 83 / 8e-20 6-phosphogluconate dehydrogenase family protein (.1.2) AT1G64190 70 / 3e-15 6-phosphogluconate dehydrogenase family protein (.1) AT5G41670 69 / 4e-15 6-phosphogluconate dehydrogenase family protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10034102 [exp] 78 / 4e-18 AT3G02360 897 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Lus10003043 [exp] 78 / 4e-18 AT3G02360 897 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Lus10024725 [exp] 73 / 2e-16 AT5G41670 896 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Lus10032341 [exp] 73 / 3e-16 AT5G41670 893 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G108880 [exp] 80 / 7e-19 AT3G02360 868 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Potri.017G106900 [exp] 80 / 9e-19 AT3G02360 918 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Potri.008G113700 [exp] 79 / 2e-18 AT3G02360 874 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Potri.004G108920 [exp] 77 / 1e-17 AT3G02360 884 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Potri.003G135600 [exp] 72 / 6e-16 AT5G41670 889 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2) Potri.001G095800 [exp] 72 / 7e-16 AT5G41670 897 / 0.0 6-phosphogluconate dehydrogenase family protein (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10029098 pacid=23151783 polypeptide=Lus10029098 locus=Lus10029098.g ID=Lus10029098.BGIv1.0 annot-version=v1.0 ATGATGCTACATTCGCATGAGCATATTGTCGATGTTTGTGAACTGCTTTTTGTTGGTATCAATTCTAATGAGTTTGCCAAAGAGATGATCGATCGTCAAT CTGCTTGGAGAGGAGTAGTCTGCCTTGCTATCAATGGAGGCATTAGCACTCCAGTCTCCAGGAATGTCTTCCAGGCACATACCTATGAGAGGATCGACAT GCCAAGATCTTTCCACACCGAATGGTTCAATATGATTGCTAGATGTTCAAAGATTTTTAACTTCCGTACTTCACTTTCTCTATTCTTACGCCTCACAACG ACACAGCCTCAATGA
AA sequence Show only first row Show all	>Lus10029098 pacid=23151783 polypeptide=Lus10029098 locus=Lus10029098.g ID=Lus10029098.BGIv1.0 annot-version=v1.0 MMLHSHEHIVDVCELLFVGINSNEFAKEMIDRQSAWRGVVCLAINGGISTPVSRNVFQAHTYERIDMPRSFHTEWFNMIARCSKIFNFRTSLSLFLRLTT TQPQ

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G02360			6-phosphogluconate dehydrogena...		Lus10029098 [exp]	0	1
					Lus10027106 [exp]	5.5	0.7281
ATCG00680		ATCG00680.1, PS...	photosystem II reaction center...		Lus10001686 [exp]	7.0	0.7645
AT4G10020		ATHSD5	hydroxysteroid dehydrogenase 5...		Lus10006178 [exp]	10.5	0.7098
ATCG00680		ATCG00680.1, PS...	photosystem II reaction center...		Lus10006594 [exp]	11.2	0.7473
AT5G65205			NAD(P)-binding Rossmann-fold s...		Lus10011729 [exp]	11.5	0.7233
ATCG00680		ATCG00680.1, PS...	photosystem II reaction center...		Lus10006593 [exp]	13.7	0.7468
ATCG00490		ATCG00490.1, RB...	ribulose-bisphosphate carboxyl...		Lus10032825 [exp]	15.0	0.7289
AT5G44150			unknown protein		Lus10035461 [exp]	16.9	0.6296
AT1G22640	MYB	AtMYB3	ARABIDOPSIS THALIANA MYB DOMA...		Lus10001043 [exp]	19.2	0.7178
AT2G04865			Aminotransferase-like, plant m...		Lus10032799 [exp]	21.8	0.6952

Compare expression of checked genes

Lus10029098 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.