Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G33355 96 / 1e-26 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) AT2G18370 64 / 3e-14 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT5G59310 60 / 2e-12 LTP4 lipid transfer protein 4 (.1) AT2G15050 60 / 2e-12 LTP7, LTP lipid transfer protein 7, lipid transfer protein (.1.2.3) AT5G59320 58 / 9e-12 LTP3 lipid transfer protein 3 (.1) AT3G51590 57 / 3e-11 LTP12 lipid transfer protein 12 (.1) AT3G08770 53 / 7e-10 LTP6 lipid transfer protein 6 (.1.2) AT2G38540 52 / 2e-09 ATLTP1, LP1 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) AT5G01870 51 / 4e-09 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) AT2G38530 49 / 2e-08 cdf3, LP2, LTP2 cell growth defect factor-3, lipid transfer protein 2 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040917 [exp] 175 / 6e-52 AT4G01030 898 / 0.0 pentatricopeptide (PPR) repeat-containing protein (.1) Lus10009813 [exp] 164 / 7e-48 AT4G01030 820 / 0.0 pentatricopeptide (PPR) repeat-containing protein (.1) Lus10001703 [exp] 129 / 1e-39 AT4G33355 86 / 9e-23 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10005156 [exp] 134 / 2e-37 AT3G55400 931 / 0.0 OVULE ABORTION 1, methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS) (.1), methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS) (.2) Lus10012392 [exp] 70 / 3e-16 AT4G33355 69 / 8e-16 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Lus10025151 [exp] 67 / 4e-15 AT5G59320 103 / 1e-29 lipid transfer protein 3 (.1) Lus10015279 [exp] 66 / 6e-15 AT5G59320 116 / 6e-35 lipid transfer protein 3 (.1) Lus10025234 [exp] 66 / 1e-14 AT2G38530 118 / 2e-35 cell growth defect factor-3, lipid transfer protein 2 (.1) Lus10015278 [exp] 65 / 2e-14 AT5G59310 110 / 1e-32 lipid transfer protein 4 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G046500 [exp] 87 / 6e-23 AT4G33355 76 / 6e-19 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2) Potri.004G086600 [exp] 66 / 5e-15 AT2G38540 122 / 3e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.004G086500 [exp] 66 / 1e-14 AT2G38540 124 / 5e-38 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1) Potri.001G232700 [exp] 63 / 1e-13 AT2G18370 93 / 1e-25 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.001G232900 [exp] 63 / 1e-13 AT2G18370 100 / 3e-28 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135700 [exp] 59 / 3e-12 AT5G59310 92 / 3e-25 lipid transfer protein 4 (.1) Potri.011G021900 [exp] 58 / 8e-12 AT3G08770 60 / 8e-13 lipid transfer protein 6 (.1.2) Potri.016G136000 [exp] 56 / 3e-11 AT5G01870 113 / 1e-33 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135800 [exp] 55 / 1e-10 AT5G01870 111 / 1e-32 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1) Potri.016G135400 [exp] 54 / 3e-10 AT5G59320 109 / 3e-32 lipid transfer protein 3 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0482 [flax] [poplar] Prolamin PF00234 [flax] [poplar] Tryp_alpha_amyl Protease inhibitor/seed storage/LTP family
Representative CDS sequence Show only first row Show all	>Lus10029445 pacid=23149406 polypeptide=Lus10029445 locus=Lus10029445.g ID=Lus10029445.BGIv1.0 annot-version=v1.0 ATGAAGGGATCATCAGTGGCAGTGATTTCAATGGTGGTTGTGGTCGCCATGGTGGCGGCAATGCCAGCTCGGGTTTCGGCCATAAACTGCGCACAAGTGA ATGCCTACTTGGCACCTTGCATTCCTTACTTGATCAACGGAGCCGCCGGCGGTGACCCTGCTCCGAAATGTTGCGAGGGAATCCTGAGCTTAAAAACCAA CACTCCTGCCGTCGAAGACCGCCGTGCGGCTTGTACTTGCCTCAAGGCCGCCGCCGGACGGTACCCAGTCAAGGACGACGCTGCTTCATCTCTCCCTACT AAATGCGGCGTCGCTGTCAGCATCCCCATCTCCAAGGCCATCGACTGCCAGAGGTACGTACGTAATAATTGA
AA sequence Show only first row Show all	>Lus10029445 pacid=23149406 polypeptide=Lus10029445 locus=Lus10029445.g ID=Lus10029445.BGIv1.0 annot-version=v1.0 MKGSSVAVISMVVVVAMVAAMPARVSAINCAQVNAYLAPCIPYLINGAAGGDPAPKCCEGILSLKTNTPAVEDRRAACTCLKAAAGRYPVKDDAASSLPT KCGVAVSIPISKAIDCQRYVRNN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G33355			Bifunctional inhibitor/lipid-t...		Lus10029445 [exp]	0	1
					Lus10022574 [exp]	4.1	0.7087
					Lus10032997 [exp]	6.3	0.6730
					Lus10024072 [exp]	16.3	0.6214
					Lus10037806 [exp]	17.0	0.5476
AT2G27830			unknown protein		Lus10009391 [exp]	18.9	0.6889
AT3G28345		MDR13, ABCB15	multi-drug resistance 13, ATP-...		Lus10039533 [exp]	32.9	0.6604
AT2G24520		AHA5	H\(+\)-ATPase 5, H\(+\)-ATPase...		Lus10020147 [exp]	44.5	0.5921
AT5G07920		ATDGK1, DGK1	DIACYLGLYCEROL KINASE 1, diacy...		Lus10015742 [exp]	47.7	0.6016
AT2G28390			SAND family protein (.1)		Lus10021472 [exp]	49.4	0.6072
AT3G05140		RBK2	ROP binding protein kinases 2 ...		Lus10018959 [exp]	53.0	0.5547

Compare expression of checked genes

Lus10029445 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.