Lus10029456 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G17600 85 / 9e-21 RING/U-box superfamily protein (.1)
AT5G10380 82 / 6e-20 ATRING1, RING1 RING/U-box superfamily protein (.1)
AT3G18930 82 / 1e-19 RING/U-box superfamily protein (.1.2)
AT4G17905 82 / 1e-19 ATL4H RING/U-box superfamily protein (.1)
AT1G72200 82 / 2e-19 RING/U-box superfamily protein (.1)
AT3G03550 80 / 6e-19 RING/U-box superfamily protein (.1)
AT5G05810 79 / 1e-18 ATL43 RING/U-box superfamily protein (.1)
AT2G35000 79 / 2e-18 ATL9 Arabidopsis toxicos en levadura 9, RING/U-box superfamily protein (.1)
AT2G27940 77 / 3e-18 RING/U-box superfamily protein (.1)
AT1G04360 78 / 4e-18 RING/U-box superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10005954 232 / 2e-77 AT3G04020 111 / 7e-28 unknown protein
Lus10025338 83 / 5e-21 AT4G17905 99 / 4e-25 RING/U-box superfamily protein (.1)
Lus10012745 84 / 3e-20 AT4G33565 168 / 4e-49 RING/U-box superfamily protein (.1)
Lus10013618 83 / 3e-20 AT5G17600 220 / 1e-69 RING/U-box superfamily protein (.1)
Lus10024405 80 / 9e-20 AT4G17905 95 / 9e-24 RING/U-box superfamily protein (.1)
Lus10031515 82 / 1e-19 AT3G05200 232 / 1e-73 RING/U-box superfamily protein (.1)
Lus10023617 81 / 2e-19 AT5G05810 219 / 1e-68 RING/U-box superfamily protein (.1)
Lus10029794 81 / 5e-19 AT1G72200 219 / 1e-66 RING/U-box superfamily protein (.1)
Lus10015901 79 / 1e-18 AT1G72220 175 / 3e-51 RING/U-box superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.010G206200 148 / 6e-47 AT5G17600 91 / 6e-22 RING/U-box superfamily protein (.1)
Potri.008G054200 129 / 3e-39 AT1G20823 80 / 6e-19 RING/U-box superfamily protein (.1)
Potri.006G144200 90 / 8e-24 AT5G17600 90 / 3e-21 RING/U-box superfamily protein (.1)
Potri.007G097500 85 / 1e-20 AT5G10380 145 / 2e-40 RING/U-box superfamily protein (.1)
Potri.001G141200 84 / 2e-20 AT5G17600 207 / 1e-63 RING/U-box superfamily protein (.1)
Potri.005G099000 81 / 4e-20 AT1G20823 146 / 2e-44 RING/U-box superfamily protein (.1)
Potri.003G093100 83 / 5e-20 AT5G17600 196 / 1e-59 RING/U-box superfamily protein (.1)
Potri.013G073500 83 / 6e-20 AT3G03550 262 / 2e-85 RING/U-box superfamily protein (.1)
Potri.002G101800 83 / 8e-20 AT1G72220 195 / 3e-58 RING/U-box superfamily protein (.1)
Potri.005G071300 82 / 1e-19 AT5G10380 135 / 1e-36 RING/U-box superfamily protein (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0229 RING PF00097 zf-C3HC4 Zinc finger, C3HC4 type (RING finger)
Representative CDS sequence
>Lus10029456 pacid=23149358 polypeptide=Lus10029456 locus=Lus10029456.g ID=Lus10029456.BGIv1.0 annot-version=v1.0
ATGGAGAGCTCGACGGCGGAGCTGATTCCGGCGTACAAGTTCTACAAGGGGATGGGGCTTATGAAGGAAGACGGCGGGACCTGCGCGATTTGTCTATGTG
AGTTCGAGGAAGGGGAGGAGTTGAAGACTCTGCCGGAGTGTATGCACTCTTTCCACGTGGGATGTATCGATATGTGGCTCTACTCACATTCGAATTGTCC
GATGTGCCGGACCGACGCTGCGCCGTCGCCTCAGGTATCTTTCCAGGCGGCCGACGTGATGGAGGTGGAACAGAGCCTGGGTGTTACGTTGCAGGGTATA
ATTGTACATTCGCGGACCAACCAGTGA
AA sequence
>Lus10029456 pacid=23149358 polypeptide=Lus10029456 locus=Lus10029456.g ID=Lus10029456.BGIv1.0 annot-version=v1.0
MESSTAELIPAYKFYKGMGLMKEDGGTCAICLCEFEEGEELKTLPECMHSFHVGCIDMWLYSHSNCPMCRTDAAPSPQVSFQAADVMEVEQSLGVTLQGI
IVHSRTNQ

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G10380 ATRING1, RING1 RING/U-box superfamily protein... Lus10029456 0 1
AT3G18590 AtENODL5 early nodulin-like protein 5 (... Lus10009617 12.9 0.7391
AT5G40960 Protein of unknown function (D... Lus10032031 14.7 0.6791
AT4G15550 IAGLU indole-3-acetate beta-D-glucos... Lus10027584 19.6 0.7208
AT5G55050 GDSL-like Lipase/Acylhydrolase... Lus10025104 25.7 0.7173
AT2G47140 AtSDR5 short-chain dehydrogenase redu... Lus10022760 30.5 0.6833
AT5G40010 ASD, AATP1 ATPase-in-Seed-Development, AA... Lus10005256 31.4 0.6521
Lus10034328 35.4 0.6688
AT1G21850 SKS8 SKU5 similar 8 (.1) Lus10022648 44.3 0.6444
Lus10022214 45.8 0.6426
Lus10022518 48.3 0.6426

Lus10029456 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.