Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G48010 71 / 3e-15 RKF3 receptor-like kinase in in flowers 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042678 [exp] 160 / 8e-47 AT2G48010 781 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10029624 [exp] 105 / 2e-27 AT2G48010 262 / 5e-80 receptor-like kinase in in flowers 3 (.1) Lus10042679 [exp] 105 / 2e-27 AT2G48010 678 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10008186 [exp] 94 / 3e-23 AT2G48010 647 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10027971 [exp] 89 / 2e-21 AT2G48010 646 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10027972 [exp] 71 / 6e-15 AT2G48010 601 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10008187 [exp] 70 / 1e-14 AT2G48010 660 / 0.0 receptor-like kinase in in flowers 3 (.1) Lus10027970 [exp] 69 / 2e-14 AT2G48010 653 / 0.0 receptor-like kinase in in flowers 3 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G136466 [exp] 85 / 5e-20 AT2G48010 792 / 0.0 receptor-like kinase in in flowers 3 (.1) Potri.014G136400 [exp] 82 / 6e-19 AT2G48010 794 / 0.0 receptor-like kinase in in flowers 3 (.1) Potri.005G040200 [exp] 56 / 4e-10 AT2G48010 613 / 0.0 receptor-like kinase in in flowers 3 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10029625 pacid=23151962 polypeptide=Lus10029625 locus=Lus10029625.g ID=Lus10029625.BGIv1.0 annot-version=v1.0 ATGAAATCTCCTCACAAAGTCAAGTTCCGCAGCCGTCTCGGCAACTACTACTCTTCCTCCGATGACCTCAGTCCTTCTATCATCTCCACCGCCGCAGCCG ACTCCATGTCCACCGCCTTCCTCCTCCTGCTCGCCGCCCTCCTAACCTCTTCCGTCGCCCAAAACTCCACCTGCCCGCTCGACTTCACAGTCCTCCAACG TCTCTACGACGGCACCAACCCTCCCGAAATCGACCCCTCTCAGAACTGCCAGTACATCCGCCAGGGCCTCCGCCTCGTCCAGTCCGAATACCTCCTCCGC ACCAACAACTTCCTCCCGCCCCTCGCCACCGCCGACTCCTGCTGGCGAGCCTACCAGCGCCTCGCCCACGACTCCCCCCGTCAATGA
AA sequence Show only first row Show all	>Lus10029625 pacid=23151962 polypeptide=Lus10029625 locus=Lus10029625.g ID=Lus10029625.BGIv1.0 annot-version=v1.0 MKSPHKVKFRSRLGNYYSSSDDLSPSIISTAAADSMSTAFLLLLAALLTSSVAQNSTCPLDFTVLQRLYDGTNPPEIDPSQNCQYIRQGLRLVQSEYLLR TNNFLPPLATADSCWRAYQRLAHDSPRQ

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G48010		RKF3	receptor-like kinase in in flo...		Lus10029625 [exp]	0	1
AT1G60900			U2 snRNP auxilliary factor, la...		Lus10037299 [exp]	3.5	0.8653
AT5G03415	E2F_DP	ATDPB, DPB	Transcription factor DP (.1.2)		Lus10014423 [exp]	3.9	0.9033
AT3G12170			Chaperone DnaJ-domain superfam...		Lus10013402 [exp]	6.9	0.8529
AT1G20920			P-loop containing nucleoside t...		Lus10035328 [exp]	10.6	0.8552
AT5G10510	AP2_ERF	PLT3, AIL6	PLETHORA 3, AINTEGUMENTA-like ...		Lus10012728 [exp]	10.8	0.8599
AT5G12330		LRP1	LATERAL ROOT PRIMORDIUM 1, Lat...		Lus10036032 [exp]	15.0	0.8434
AT5G19910		MED31	SOH1 family protein (.1.2)		Lus10016131 [exp]	17.7	0.8600
AT1G63500			Protein kinase protein with te...		Lus10001998 [exp]	22.2	0.8240
AT1G22310		ATMBD8, MBD8	methyl-CPG-binding domain 8 (....		Lus10035631 [exp]	23.3	0.8337
AT1G44910		ATPRP40A	pre-mRNA-processing protein 40...		Lus10007723 [exp]	24.7	0.8335

Compare expression of checked genes

Lus10029625 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.