Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G21550 69 / 6e-16 Calcium-binding EF-hand family protein (.1) AT1G05990 48 / 5e-08 RHS1 ,RHS2 ROOT HAIR SPECIFIC 1, EF hand calcium-binding protein family (.1) AT4G20780 48 / 8e-08 CML42 calmodulin like 42 (.1) AT2G43290 43 / 4e-06 MSS3 multicopy suppressors of snf4 deficiency in yeast 3, Calcium-binding EF-hand family protein (.1) AT5G44460 41 / 2e-05 CML43 calmodulin like 43 (.1) AT3G59440 41 / 3e-05 Calcium-binding EF-hand family protein (.1) AT4G03290 40 / 3e-05 EF hand calcium-binding protein family (.1) AT5G37770 40 / 3e-05 CML24, TCH2 TOUCH 2, CALMODULIN-LIKE 24, EF hand calcium-binding protein family (.1) AT1G66400 39 / 7e-05 CML23 calmodulin like 23 (.1) AT4G12860 39 / 8e-05 UNE14 unfertilized embryo sac 14, EF hand calcium-binding protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042761 [exp] 117 / 5e-35 AT1G21550 70 / 7e-16 Calcium-binding EF-hand family protein (.1) Lus10040888 [exp] 114 / 8e-35 AT1G21550 54 / 8e-11 Calcium-binding EF-hand family protein (.1) Lus10000972 [exp] 103 / 3e-29 AT1G21550 128 / 3e-38 Calcium-binding EF-hand family protein (.1) Lus10028657 [exp] 98 / 4e-27 AT1G21550 122 / 9e-36 Calcium-binding EF-hand family protein (.1) Lus10042762 [exp] 50 / 2e-08 AT1G77260 741 / 0.0 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (.1) Lus10009564 [exp] 48 / 5e-08 AT3G07490 233 / 7e-80 calmodulin-like 3, ARF-GAP domain 11 (.1) Lus10003239 [exp] 43 / 6e-06 AT4G20780 249 / 5e-85 calmodulin like 42 (.1) Lus10021134 [exp] 43 / 7e-06 AT4G20780 236 / 8e-80 calmodulin like 42 (.1) Lus10017174 [exp] 39 / 0.0001 AT4G20780 234 / 4e-79 calmodulin like 42 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G183300 [exp] 92 / 6e-25 AT1G21550 136 / 1e-41 Calcium-binding EF-hand family protein (.1) Potri.002G077300 [exp] 90 / 3e-24 AT1G21550 123 / 3e-36 Calcium-binding EF-hand family protein (.1) Potri.017G029700 [exp] 45 / 6e-07 AT3G07490 192 / 1e-62 calmodulin-like 3, ARF-GAP domain 11 (.1) Potri.007G128600 [exp] 45 / 6e-07 AT2G43290 218 / 3e-72 multicopy suppressors of snf4 deficiency in yeast 3, Calcium-binding EF-hand family protein (.1) Potri.004G089400 [exp] 41 / 2e-05 AT1G66400 157 / 7e-50 calmodulin like 23 (.1) Potri.006G112500 [exp] 41 / 2e-05 AT4G20780 238 / 2e-80 calmodulin like 42 (.1) Potri.017G126200 [exp] 40 / 3e-05 AT1G66400 155 / 5e-49 calmodulin like 23 (.1) Potri.005G259900 [exp] 38 / 0.0003 AT1G76650 156 / 2e-48 calmodulin-like 38 (.1.2.3) Potri.016G142000 [exp] 38 / 0.0003 AT4G20780 197 / 3e-64 calmodulin like 42 (.1) Potri.002G239100 [exp] 37 / 0.0004 AT3G07490 248 / 8e-86 calmodulin-like 3, ARF-GAP domain 11 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10029730 pacid=23152025 polypeptide=Lus10029730 locus=Lus10029730.g ID=Lus10029730.BGIv1.0 annot-version=v1.0 ATGTCCCCCGGCGACGGCGGACTCAACGCCAACGACTTGCGGCGGATCTTCCACCAGCTGGACCGGAACGGGGACGGCATTCTCAGCGTCGACGAGCTGA GCTGGCTTCTCGAGCGAATCGGAGCAAGCAGCAGCCACTTCACGATCGACGAGCTGGAGTCTTCCGTAGGGAAATCCTGCCTCGATTTCGACGAGTTCTT GGAATTCTACCGCTCAATTTCCGGTGGCGGAGGAGATGACGGAGGAGAGAAGGATTTGAAGAGGCGTTCAGAGTGTTCGACTTGA
AA sequence Show only first row Show all	>Lus10029730 pacid=23152025 polypeptide=Lus10029730 locus=Lus10029730.g ID=Lus10029730.BGIv1.0 annot-version=v1.0 MSPGDGGLNANDLRRIFHQLDRNGDGILSVDELSWLLERIGASSSHFTIDELESSVGKSCLDFDEFLEFYRSISGGGGDDGGEKDLKRRSECST

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G21550			Calcium-binding EF-hand family...		Lus10029730 [exp]	0	1
AT3G26230		CYP71B24	"cytochrome P450, family 71, s...		Lus10034397 [exp]	3.0	0.6846
AT2G45330		TRPT, EMB1067	2' tRNA phosphotransferase, em...		Lus10015875 [exp]	6.7	0.6125
AT3G12130	C3HZnF		KH domain-containing protein /...		Lus10012016 [exp]	12.6	0.6236
AT5G61310			Cytochrome c oxidase subunit V...		Lus10040012 [exp]	18.9	0.6131
AT4G10270			Wound-responsive family protei...		Lus10033729 [exp]	39.2	0.6068
					Lus10035698 [exp]	43.4	0.5759
AT3G60630	GRAS	ATHAM2, LOM2	LOST MERISTEMS 2, ARABIDOPSIS ...		Lus10002205 [exp]	51.6	0.5595
AT5G58890	MADS	AGL82	AGAMOUS-like 82 (.1)		Lus10020789 [exp]	62.9	0.5166
AT4G34660			SH3 domain-containing protein ...		Lus10028785 [exp]	70.5	0.5372
AT4G37440			unknown protein		Lus10011519 [exp]	81.2	0.4928

Compare expression of checked genes

Lus10029730 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.