Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G22390 40 / 0.0001 F-box associated ubiquitination effector family protein (.1) AT3G06240 40 / 0.0001 F-box family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038606 [exp] 176 / 3e-55 AT3G07870 112 / 1e-27 F-box and associated interaction domains-containing protein (.1) Lus10037892 [exp] 173 / 3e-54 AT3G06240 107 / 7e-26 F-box family protein (.1) Lus10013873 [exp] 55 / 5e-10 AT3G06240 104 / 2e-24 F-box family protein (.1) Lus10026587 [exp] 51 / 1e-08 AT3G06240 104 / 3e-24 F-box family protein (.1) Lus10038603 [exp] 44 / 7e-06 AT3G06240 110 / 2e-26 F-box family protein (.1) Lus10040800 [exp] 39 / 0.0004 AT3G21120 84 / 8e-18 F-box and associated interaction domains-containing protein (.1) Lus10031020 [exp] 38 / 0.0005 AT3G10430 88 / 3e-19 F-box and associated interaction domains-containing protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G262900 [exp] 75 / 4e-17 AT4G12560 107 / 5e-26 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.010G207500 [exp] 52 / 6e-09 AT4G12560 94 / 3e-21 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.008G006900 [exp] 52 / 8e-09 AT4G12560 95 / 3e-21 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.003G145950 [exp] 51 / 1e-08 AT4G12560 113 / 7e-28 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.017G058900 [exp] 50 / 3e-08 AT3G06240 132 / 2e-34 F-box family protein (.1) Potri.011G121200 [exp] 49 / 5e-08 AT4G12560 116 / 9e-29 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.008G006800 [exp] 46 / 8e-07 AT4G12560 100 / 4e-23 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.001G318300 [exp] 45 / 2e-06 AT3G06240 140 / 7e-38 F-box family protein (.1) Potri.015G013800 [exp] 43 / 8e-06 AT4G12560 105 / 7e-25 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2) Potri.006G013000 [exp] 43 / 1e-05 AT4G12560 250 / 5e-79 CONSTITUTIVE EXPRESSER OF PR GENES 30, CONSTITUTIVE EXPRESSER OF PR GENES 1, F-box and associated interaction domains-containing protein (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10029856 pacid=23159783 polypeptide=Lus10029856 locus=Lus10029856.g ID=Lus10029856.BGIv1.0 annot-version=v1.0 ATGGTCCCCAGCAAGAACCCATCCATCCGCAAGACCTTCAATCTTTCTTTACCTGGCGTCACTTTCGACACCCACGGCGCTTTCGAAGCTCTTCTAGGGT TCGGATTCGATTCCCCCGCCCAGTATTACAAAGTAGCGAGAGTCTTGCGGCTCCTCGAGAGAGACGATGTTGAAATCGAAGTTGAAGTTTTCTCCTTCAA CGCCCGATCCTGGAAGAGGATTATAACTCCCAGAGCGCCGCAGTACAACATCGTGGAGCACGGGTCTCAGGCTTTCATCAACGGGTCGGTCCACTGGGAC CCCAGGGGGAGGCAGCGGCAACAGAGATAA
AA sequence Show only first row Show all	>Lus10029856 pacid=23159783 polypeptide=Lus10029856 locus=Lus10029856.g ID=Lus10029856.BGIv1.0 annot-version=v1.0 MVPSKNPSIRKTFNLSLPGVTFDTHGAFEALLGFGFDSPAQYYKVARVLRLLERDDVEIEVEVFSFNARSWKRIITPRAPQYNIVEHGSQAFINGSVHWD PRGRQRQQR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10029856 [exp]	0	1
AT3G07720			Galactose oxidase/kelch repeat...		Lus10012345 [exp]	4.2	0.8430
AT4G20880			ethylene-responsive nuclear pr...		Lus10023347 [exp]	12.0	0.8472
AT1G18590		SOT17, ATSOT17,...	ARABIDOPSIS SULFOTRANSFERASE 5...		Lus10017878 [exp]	15.5	0.8246
AT5G56460			Protein kinase superfamily pro...		Lus10013406 [exp]	29.2	0.7976
AT4G24570		DIC2	dicarboxylate carrier 2 (.1)		Lus10015570 [exp]	29.9	0.8061
					Lus10023370 [exp]	34.8	0.7994
AT5G42660			Protein of unknown function (D...		Lus10024684 [exp]	36.6	0.7847
AT1G48880		TBL7	TRICHOME BIREFRINGENCE-LIKE 7 ...		Lus10029761 [exp]	47.0	0.7888
AT5G63130			Octicosapeptide/Phox/Bem1p fam...		Lus10017947 [exp]	48.2	0.7987
					Lus10011339 [exp]	58.5	0.7829

Compare expression of checked genes

Lus10029856 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.