Lus10030037 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G31130 119 / 2e-35 Protein of unknown function (DUF1218) (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10014344 149 / 4e-47 AT4G31130 292 / 7e-102 Protein of unknown function (DUF1218) (.1)
Lus10026052 146 / 8e-46 AT4G31130 287 / 6e-100 Protein of unknown function (DUF1218) (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.006G280900 119 / 5e-35 AT4G31130 253 / 2e-86 Protein of unknown function (DUF1218) (.1)
Potri.018G000600 115 / 1e-33 AT4G31130 277 / 4e-96 Protein of unknown function (DUF1218) (.1)
Potri.007G002900 84 / 3e-21 AT4G31130 179 / 4e-57 Protein of unknown function (DUF1218) (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF06749 DUF1218 Protein of unknown function (DUF1218)
Representative CDS sequence
>Lus10030037 pacid=23159787 polypeptide=Lus10030037 locus=Lus10030037.g ID=Lus10030037.BGIv1.0 annot-version=v1.0
ATGTATGAACTATCGGTTGGCAGATTCACCGGCGGTTTAGCTGCAGCGCTGCTGCTGTGGCCAACGATCACAGAACAGCTTCACTTGTCCAGGAACGTTC
ATCACAATCTCGAGACCCAATGCCTGACTGCTAAGACTGGCCTGCTGGGTGGTGGTGCTTTCGTTTCTCTAGATTCGGCTCTCTTCTGGCTGGTCGCGCT
CATGCTGGCCGATAATGCTCGAGAGGATTACTTCGAGGAGGTTGAGAACAACGGCAAGGCAACATCTGCTGCTGATCTCGATGACCCTTCTGCTCTCAAG
GGCACTTTCGCATAG
AA sequence
>Lus10030037 pacid=23159787 polypeptide=Lus10030037 locus=Lus10030037.g ID=Lus10030037.BGIv1.0 annot-version=v1.0
MYELSVGRFTGGLAAALLLWPTITEQLHLSRNVHHNLETQCLTAKTGLLGGGAFVSLDSALFWLVALMLADNAREDYFEEVENNGKATSAADLDDPSALK
GTFA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G31130 Protein of unknown function (D... Lus10030037 0 1
AT4G31130 Protein of unknown function (D... Lus10030038 1.0 0.8844
AT5G07920 ATDGK1, DGK1 DIACYLGLYCEROL KINASE 1, diacy... Lus10034702 4.5 0.8452
AT5G42510 Disease resistance-responsive ... Lus10038298 5.3 0.8203
AT5G02790 GSTL3 Glutathione transferase L3, Gl... Lus10003994 9.8 0.8219
AT2G37570 SLT1 sodium- and lithium-tolerant 1... Lus10024406 23.9 0.7798
AT3G22560 Acyl-CoA N-acyltransferases (N... Lus10039343 24.2 0.7459
AT1G07530 GRAS SCL14, ATGRAS2 GRAS \(GAI, RGA, SCR\) 2, ARAB... Lus10004968 31.7 0.7805
AT5G58920 unknown protein Lus10040699 33.7 0.7877
AT5G04750 F1F0-ATPase inhibitor protein,... Lus10034146 34.3 0.8071
AT3G57090 FIS1A, BIGYIN FISSION 1A, Tetratricopeptide ... Lus10009706 35.4 0.7825

Lus10030037 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.