Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G01250 67 / 1e-14 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT5G25810 50 / 5e-08 AP2_ERF TNY, TINY TINY, Integrase-type DNA-binding superfamily protein (.1) AT3G60490 47 / 4e-07 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT5G11590 47 / 5e-07 AP2_ERF DREB3, TINY2 TINY2, Integrase-type DNA-binding superfamily protein (.1) AT2G44940 47 / 7e-07 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT3G16280 45 / 2e-06 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT4G32800 45 / 3e-06 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT4G16750 44 / 4e-06 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT2G35700 44 / 7e-06 AP2_ERF ATERF38 ERF family protein 38 (.1) AT2G25820 43 / 1e-05 AP2_ERF ESE2 ethylene and salt inducible 2, Integrase-type DNA-binding superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005967 [exp] 145 / 3e-45 AT1G01250 141 / 1e-42 Integrase-type DNA-binding superfamily protein (.1) Lus10007799 [exp] 50 / 2e-08 AT2G44940 136 / 7e-42 Integrase-type DNA-binding superfamily protein (.1) Lus10023873 [exp] 49 / 4e-08 AT2G36450 121 / 3e-35 HARDY, Integrase-type DNA-binding superfamily protein (.1) Lus10014376 [exp] 50 / 5e-08 AT2G36450 167 / 2e-52 HARDY, Integrase-type DNA-binding superfamily protein (.1) Lus10004738 [exp] 50 / 6e-08 AT2G35700 144 / 7e-44 ERF family protein 38 (.1) Lus10002801 [exp] 49 / 1e-07 AT5G11590 209 / 4e-68 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10034949 [exp] 44 / 6e-06 AT4G32800 169 / 3e-51 Integrase-type DNA-binding superfamily protein (.1) Lus10038270 [exp] 43 / 1e-05 AT5G11590 168 / 4e-52 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10025834 [exp] 42 / 5e-05 AT5G11590 164 / 2e-50 TINY2, Integrase-type DNA-binding superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G172200 [exp] 67 / 1e-14 AT1G01250 177 / 6e-57 Integrase-type DNA-binding superfamily protein (.1) Potri.014G099900 [exp] 64 / 1e-13 AT1G01250 191 / 4e-62 Integrase-type DNA-binding superfamily protein (.1) Potri.002G172300 [exp] 62 / 7e-13 AT1G01250 177 / 6e-57 Integrase-type DNA-binding superfamily protein (.1) Potri.003G050700 [exp] 50 / 4e-08 AT5G11590 166 / 5e-51 TINY2, Integrase-type DNA-binding superfamily protein (.1) Potri.019G067400 [exp] 49 / 5e-08 AT5G25810 120 / 6e-34 TINY, Integrase-type DNA-binding superfamily protein (.1) Potri.006G021000 [exp] 49 / 8e-08 AT2G36450 122 / 5e-35 HARDY, Integrase-type DNA-binding superfamily protein (.1) Potri.016G018600 [exp] 49 / 8e-08 AT2G36450 135 / 7e-40 HARDY, Integrase-type DNA-binding superfamily protein (.1) Potri.014G055700 [exp] 49 / 1e-07 AT2G44940 206 / 2e-65 Integrase-type DNA-binding superfamily protein (.1) Potri.003G079300 [exp] 47 / 3e-07 AT4G16750 150 / 7e-46 Integrase-type DNA-binding superfamily protein (.1) Potri.018G043900 [exp] 47 / 3e-07 AT5G11590 212 / 5e-69 TINY2, Integrase-type DNA-binding superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10030242 pacid=23152995 polypeptide=Lus10030242 locus=Lus10030242.g ID=Lus10030242.BGIv1.0 annot-version=v1.0 ATGGCCGCCAAGGCGTACAACGTCGCAGCGCACTGCCTCAAAGGACGCAGCGCCCTCCTCAATTTCCCCGACCAGGTCAACGACTTACCCACTCCTGCCA CGTGTCGCTCTCCCAGGGACATCCAGGCCGCCGCCGCCGTAGCCGCACGGTCCGTTATTATCCGTCATCATTCCTCCTCTTCCTCCTCGCCCAGCTCCTC GCCGTTAAGTGACGGCGCTGGGGGTAACGGAGTTGAGAGGAGTGATAATGAGGATGAGGATGGTGACGGCGGGTTTTGGGAGGAGATTGAGTTGCCGGAA CTGCTCATTACCAGCAGTAGTAGCTGTGATGAGCTGTGGAGTTTGGCTGCCGGCGGGAAGGATTCTGCGGCGGATTGGTAG
AA sequence Show only first row Show all	>Lus10030242 pacid=23152995 polypeptide=Lus10030242 locus=Lus10030242.g ID=Lus10030242.BGIv1.0 annot-version=v1.0 MAAKAYNVAAHCLKGRSALLNFPDQVNDLPTPATCRSPRDIQAAAAVAARSVIIRHHSSSSSSPSSSPLSDGAGGNGVERSDNEDEDGDGGFWEEIELPE LLITSSSSCDELWSLAAGGKDSAADW

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G01250	AP2_ERF		Integrase-type DNA-binding sup...		Lus10030242 [exp]	0	1
AT1G64380	AP2_ERF		Integrase-type DNA-binding sup...		Lus10001898 [exp]	6.2	0.8416
AT2G38270		ATGRX2, CXIP2	GLUTAREDOXIN, CAX-interacting ...		Lus10002847 [exp]	12.7	0.8454
AT4G24930			thylakoid lumenal 17.9 kDa pro...		Lus10028969 [exp]	13.9	0.8455
AT2G01940	C2H2ZnF	SGR5, ATIDD15	SHOOT GRAVITROPISM 5, ARABIDOP...		Lus10042288 [exp]	21.8	0.8035
AT4G03230			S-locus lectin protein kinase ...		Lus10031591 [exp]	24.4	0.8049
AT4G14870		SECE1	secE/sec61-gamma protein trans...		Lus10010555 [exp]	29.4	0.8267
AT4G01060	MYB	CPL3, ETC3	ENHANCER OF TRY AND CPC 3, CAP...		Lus10005949 [exp]	30.4	0.8280
AT2G44760			Domain of unknown function (DU...		Lus10029792 [exp]	31.0	0.8238
AT2G06520		PSBX	photosystem II subunit X (.1)		Lus10033434 [exp]	33.7	0.8377
AT3G61870			unknown protein		Lus10010112 [exp]	37.9	0.8336

Compare expression of checked genes

Lus10030242 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.