Plant FIBer expression Database

Lus10030922 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G47890 139 / 2e-44 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10040122
[exp]
173 / 5e-58 AT5G47890 150 / 8e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Lus10011053
[exp]
169 / 4e-56 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Lus10003023
[exp]
167 / 2e-55 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.001G071900
[exp]
157 / 2e-51 AT5G47890 145 / 8e-47 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Potri.003G159100
[exp]
148 / 4e-48 AT5G47890 152 / 1e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0172 Thioredoxin PF05047 L51_S25_CI-B8 Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain
Representative CDS sequence
>Lus10030922 pacid=23166728 polypeptide=Lus10030922 locus=Lus10030922.g ID=Lus10030922.BGIv1.0 annot-version=v1.0
ATGGCGTGGAGAGGGCAGCTTTCTCGGAATCTCAAGGAGCTTAGGATCCTTCTCTATCAGTCCTCTCCTTCAAGCTCCTCCACTAGAGCTTTCGTGGAGA
AGAATTACAAGGATCTCAAGACTCTCAACCCCAAAATCCCTATCTTGATTCGCGAATGCAGGGGTGTTGAACCCCAGCTCTGGGCTAGATACGATATGGG
CGTTGAGAGGGGCGTACGTTTGGAGGGCAAGGACGAGTCGCAGATCTCCAAGGCACTTGAAGAACTTGTGAAAGTTGGTGCTGCACTCAAACAATAG
AA sequence
>Lus10030922 pacid=23166728 polypeptide=Lus10030922 locus=Lus10030922.g ID=Lus10030922.BGIv1.0 annot-version=v1.0
MAWRGQLSRNLKELRILLYQSSPSSSSTRAFVEKNYKDLKTLNPKIPILIRECRGVEPQLWARYDMGVERGVRLEGKDESQISKALEELVKVGAALKQ

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G47890 NADH-ubiquinone oxidoreductase... Lus10030922
[exp]
0 1
AT5G64680 unknown protein Lus10011265
[exp]
1.0 0.9104
AT4G31720 STG1, TAFII15, ... TBP-ASSOCIATED FACTOR 10, SALT... Lus10005077
[exp]
3.2 0.8891
AT4G28830 S-adenosyl-L-methionine-depend... Lus10043228
[exp]
5.1 0.9051
AT5G15220 Ribosomal protein L27 family p... Lus10007170
[exp]
5.5 0.8985
AT1G03330 Small nuclear ribonucleoprotei... Lus10042686
[exp]
8.2 0.8925
AT4G14965 ATMAPR4 membrane-associated progestero... Lus10018026
[exp]
9.7 0.8661
AT3G10530 Transducin/WD40 repeat-like su... Lus10035742
[exp]
9.8 0.8795
AT3G25120 Mitochondrial import inner mem... Lus10008094
[exp]
9.9 0.8786
AT4G14965 ATMAPR4 membrane-associated progestero... Lus10042022
[exp]
11.0 0.8734
AT3G07180 GPI transamidase component PIG... Lus10022779
[exp]
11.0 0.8336

Lus10030922 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.