Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G68310 71 / 1e-16 AE7 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) AT3G50845 62 / 3e-13 Protein of unknown function (DUF59) (.1) AT3G09380 53 / 6e-10 Protein of unknown function (DUF59) (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10035403 [exp] 76 / 1e-18 AT1G68310 230 / 7e-79 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) Lus10031006 [exp] 76 / 1e-18 AT1G68310 233 / 1e-79 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) Lus10026019 [exp] 62 / 2e-13 AT3G50845 253 / 9e-88 Protein of unknown function (DUF59) (.1) Lus10014311 [exp] 62 / 2e-13 AT3G50845 253 / 1e-87 Protein of unknown function (DUF59) (.1) Lus10035404 [exp] 56 / 8e-11 AT1G68310 199 / 8e-66 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) Lus10031008 [exp] 55 / 8e-10 AT3G10740 783 / 0.0 ARABIDOPSIS THALIANA ALPHA-L-ARABINOFURANOSIDASE 1, alpha-L-arabinofuranosidase 1 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G098000 [exp] 74 / 8e-18 AT1G68310 257 / 2e-89 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) Potri.001G135800 [exp] 74 / 9e-18 AT1G68310 243 / 8e-84 AS1/2 ENHANCER7, Protein of unknown function (DUF59) (.1), Protein of unknown function (DUF59) (.2) Potri.005G123100 [exp] 64 / 7e-14 AT3G50845 237 / 2e-81 Protein of unknown function (DUF59) (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10031007 pacid=23166875 polypeptide=Lus10031007 locus=Lus10031007.g ID=Lus10031007.BGIv1.0 annot-version=v1.0 ATGGTCCTTCGGTCTGCATTTCCGGTGGATATCAGGGTTGCGCCTGGAACACATGCAACTGAAGCTGCAGAGAACAAAACAGTAAACGACAAGGAGCAAA TAGCAGCAGCTTTGGAGAACCCTAACCTTGTTGACGTGGTTGACGAACCTAGCTCCATCATACGCTTGAAACCAGATTGTTACCTTTGCGGCTACATGCT GTCCATAATCAAGCCGGTCCAGAGTGAGTTGAAGAATCTGAGTTGCTATATGAATCTGGAATTGGCTTCACATACTTTGACATCATTTGATTTGTTGCTG GCCAAATGA
AA sequence Show only first row Show all	>Lus10031007 pacid=23166875 polypeptide=Lus10031007 locus=Lus10031007.g ID=Lus10031007.BGIv1.0 annot-version=v1.0 MVLRSAFPVDIRVAPGTHATEAAENKTVNDKEQIAAALENPNLVDVVDEPSSIIRLKPDCYLCGYMLSIIKPVQSELKNLSCYMNLELASHTLTSFDLLL AK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G68310		AE7	AS1/2 ENHANCER7, Protein of un...		Lus10031007 [exp]	0	1
AT5G45670			GDSL-like Lipase/Acylhydrolase...		Lus10002774 [exp]	1.0	0.9994
AT4G31920	GARP	ARR10	response regulator 10 (.1)		Lus10025044 [exp]	1.4	0.9987
AT4G23310		CRK23	cysteine-rich RLK (RECEPTOR-li...		Lus10009583 [exp]	3.0	0.9911
AT5G13825			unknown protein		Lus10000042 [exp]	4.0	0.9887
					Lus10014195 [exp]	4.2	0.9831
					Lus10002411 [exp]	4.5	0.9849
AT5G06570			alpha/beta-Hydrolases superfam...		Lus10008441 [exp]	5.7	0.9756
					Lus10019564 [exp]	5.9	0.9771
AT2G16460			Protein of unknown function (D...		Lus10041812 [exp]	6.7	0.9747
					Lus10020194 [exp]	8.9	0.9667

Compare expression of checked genes

Lus10031007 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.