Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G24930 47 / 1e-07 CO COL4, ATCOL4 CONSTANS-like 4 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042431 [exp] 132 / 2e-40 AT5G24930 180 / 7e-55 CONSTANS-like 4 (.1) Lus10026238 [exp] 112 / 6e-32 AT5G24930 163 / 9e-48 CONSTANS-like 4 (.1) Lus10026909 [exp] 66 / 4e-14 AT5G24930 404 / 3e-140 CONSTANS-like 4 (.1) Lus10020105 [exp] 59 / 1e-11 AT5G24930 398 / 6e-138 CONSTANS-like 4 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.018G013800 [exp] 53 / 7e-10 AT5G24930 348 / 2e-118 CONSTANS-like 4 (.1) Potri.006G267700 [exp] 48 / 7e-08 AT5G24930 361 / 1e-123 CONSTANS-like 4 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10031016 pacid=23166746 polypeptide=Lus10031016 locus=Lus10031016.g ID=Lus10031016.BGIv1.0 annot-version=v1.0 ATGGAGTATGTGGATCCGAAGTTGGAAGCGCGGGAGCAGAACAGTTCGGGAGCTGACGGAGTTGTCCCGGAGCATATCAACGAGGCCGCCGGCGGAGGTA ATCATCATCAAGCTCCGATGCTCATGAACAACGACCACTGCGTTGATCTCGATTTCTCCGCCACCATTGAAGAATCCAAGGGCTTCCCCTACGGCTACCA GTGCTTGAGCCACAGTGTGAATTTCACTAAAAGAGAGGACTAA
AA sequence Show only first row Show all	>Lus10031016 pacid=23166746 polypeptide=Lus10031016 locus=Lus10031016.g ID=Lus10031016.BGIv1.0 annot-version=v1.0 MEYVDPKLEAREQNSSGADGVVPEHINEAAGGGNHHQAPMLMNNDHCVDLDFSATIEESKGFPYGYQCLSHSVNFTKRED

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10031016 [exp]	0	1
AT4G28530	NAC	ANAC074	NAC domain containing protein ...		Lus10022915 [exp]	12.2	0.8171
AT2G19760		PRF1, PFN1	profilin 1 (.1)		Lus10011138 [exp]	13.8	0.8097
AT2G38480			Uncharacterised protein family...		Lus10012216 [exp]	20.1	0.7998
AT3G59350			Protein kinase superfamily pro...		Lus10026706 [exp]	27.0	0.8032
AT1G60940		SNRK2-10, SNRK2...	SNF1-RELATED KINASE 2B, SUCROS...		Lus10001367 [exp]	30.9	0.8138
AT5G19070			SNARE associated Golgi protein...		Lus10004421 [exp]	35.7	0.8081
AT2G32150			Haloacid dehalogenase-like hyd...		Lus10010537 [exp]	44.7	0.7883
AT4G36890		IRX14	irregular xylem 14, Nucleotide...		Lus10033785 [exp]	57.1	0.7952
AT1G70520		ASG6, CRK2	ALTERED SEED GERMINATION 6, cy...		Lus10029123 [exp]	71.7	0.7841
AT4G36660			Protein of unknown function (D...		Lus10010810 [exp]	73.9	0.7647

Compare expression of checked genes

Lus10031016 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.