Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G20860 159 / 2e-48 ATNEK5 NIMA-related kinase 5 (.1) AT3G44200 134 / 1e-37 IBO1, ATNEK6 "NIMA \(never in mitosis, gene A\)-related 6", NIMA-RELATED KINASE6, NIMA (never in mitosis, gene A)-related 6 (.1) AT1G54510 130 / 1e-36 ATNEK1 NIMA-related serine/threonine kinase 1 (.1.2.3) AT5G28290 123 / 5e-34 ATNEK3 NIMA-related kinase 3 (.1) AT3G04810 122 / 1e-33 ATNEK2 NIMA-related kinase 2 (.1.2) AT3G63280 120 / 3e-33 ATNEK4 NIMA-related kinase 4 (.1.2) AT3G12200 107 / 3e-28 ATNEK7 NIMA-related kinase 7 (.1.2) AT3G53930 57 / 2e-10 Protein kinase superfamily protein (.1.2) AT1G73690 56 / 3e-10 CDKD1;1, AT;CDKD;1, CAK3AT cyclin-dependent kinase D1;1 (.1) AT1G30640 54 / 1e-09 Protein kinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031834 [exp] 210 / 1e-67 AT3G20860 563 / 0.0 NIMA-related kinase 5 (.1) Lus10040499 [exp] 145 / 8e-42 AT3G20860 476 / 2e-164 NIMA-related kinase 5 (.1) Lus10011301 [exp] 144 / 4e-41 AT3G20860 470 / 2e-157 NIMA-related kinase 5 (.1) Lus10001857 [exp] 126 / 5e-35 AT3G44200 854 / 0.0 "NIMA \(never in mitosis, gene A\)-related 6", NIMA-RELATED KINASE6, NIMA (never in mitosis, gene A)-related 6 (.1) Lus10013338 [exp] 126 / 7e-35 AT3G44200 845 / 0.0 "NIMA \(never in mitosis, gene A\)-related 6", NIMA-RELATED KINASE6, NIMA (never in mitosis, gene A)-related 6 (.1) Lus10042632 [exp] 125 / 8e-35 AT3G04810 671 / 0.0 NIMA-related kinase 2 (.1.2) Lus10009186 [exp] 125 / 1e-34 AT1G54510 695 / 0.0 NIMA-related serine/threonine kinase 1 (.1.2.3) Lus10015928 [exp] 125 / 1e-34 AT1G54510 694 / 0.0 NIMA-related serine/threonine kinase 1 (.1.2.3) Lus10001783 [exp] 124 / 2e-34 AT1G54510 705 / 0.0 NIMA-related serine/threonine kinase 1 (.1.2.3)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G018700 [exp] 163 / 6e-49 AT3G20860 503 / 1e-175 NIMA-related kinase 5 (.1) Potri.003G205400 [exp] 157 / 7e-47 AT3G20860 486 / 5e-169 NIMA-related kinase 5 (.1) Potri.006G056300 [exp] 156 / 6e-46 AT3G20860 473 / 2e-162 NIMA-related kinase 5 (.1) Potri.016G051900 [exp] 155 / 1e-45 AT3G20860 474 / 5e-163 NIMA-related kinase 5 (.1) Potri.001G218100 [exp] 135 / 5e-38 AT3G44200 895 / 0.0 "NIMA \(never in mitosis, gene A\)-related 6", NIMA-RELATED KINASE6, NIMA (never in mitosis, gene A)-related 6 (.1) Potri.009G020100 [exp] 135 / 5e-38 AT3G44200 869 / 0.0 "NIMA \(never in mitosis, gene A\)-related 6", NIMA-RELATED KINASE6, NIMA (never in mitosis, gene A)-related 6 (.1) Potri.005G051600 [exp] 128 / 8e-36 AT3G04810 699 / 0.0 NIMA-related kinase 2 (.1.2) Potri.002G049400 [exp] 127 / 2e-35 AT3G04810 659 / 0.0 NIMA-related kinase 2 (.1.2) Potri.013G039000 [exp] 122 / 2e-33 AT1G54510 694 / 0.0 NIMA-related serine/threonine kinase 1 (.1.2.3) Potri.014G107000 [exp] 57 / 2e-10 AT3G61960 652 / 0.0 Protein kinase superfamily protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0016 [flax] [poplar] PKinase PF00069 [flax] [poplar] Pkinase Protein kinase domain
Representative CDS sequence Show only first row Show all	>Lus10031264 pacid=23151030 polypeptide=Lus10031264 locus=Lus10031264.g ID=Lus10031264.BGIv1.0 annot-version=v1.0 ATGGAAGGGAGGAGTACTAGAGGAGGAGAAGACGATTACGAAGTGAATGAGCAGATAGGGAGGGGGAGATTCGGAGCTGCGTTTCTCGTCATTCGTAAGT CGGAGAACAAGAGGTATGTGATGAAGAAGATCAAGTTGGCTAGGCAGACTGAAAGGTTCAAGCAGACTGCTATCCAGGAGATGAACTTGATAGCCAAGTT GAATCACCCGTACATAGTGGAGTACAAGGACTCCTGGGTTGGAAAGGAATGCGTGTGTATCGTTACAAATTACTGCGAGGGTGGCGACATGACTCAGGTG ATAAGGAAAGCTAGAGGCTCTAAAGGTCTTGATTTTTGA
AA sequence Show only first row Show all	>Lus10031264 pacid=23151030 polypeptide=Lus10031264 locus=Lus10031264.g ID=Lus10031264.BGIv1.0 annot-version=v1.0 MEGRSTRGGEDDYEVNEQIGRGRFGAAFLVIRKSENKRYVMKKIKLARQTERFKQTAIQEMNLIAKLNHPYIVEYKDSWVGKECVCIVTNYCEGGDMTQV IRKARGSKGLDF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G20860		ATNEK5	NIMA-related kinase 5 (.1)		Lus10031264 [exp]	0	1
AT1G19630		CYP722A1	"cytochrome P450, family 722, ...		Lus10024272 [exp]	1.4	0.9837
AT1G30900		VSR6, VSR3;3, B...	VACUOLAR SORTING RECEPTOR 3;3,...		Lus10006944 [exp]	2.4	0.9782
AT3G20860		ATNEK5	NIMA-related kinase 5 (.1)		Lus10031265 [exp]	4.2	0.9650
AT1G27920		MAP65-8	microtubule-associated protein...		Lus10015789 [exp]	5.7	0.9642
AT2G38060		PHT4;2	phosphate transporter 4;2 (.1)		Lus10027761 [exp]	6.9	0.9600
AT5G17890		CHS3, DAR4	CHILLING SENSITIVE 3, DA1-rela...		Lus10025852 [exp]	7.3	0.9369
AT1G13635			DNA glycosylase superfamily pr...		Lus10019199 [exp]	7.4	0.9622
AT5G01180		ATPTR5	ARABIDOPSIS THALIANA PEPTIDE T...		Lus10035516 [exp]	8.0	0.9487
AT5G57830			Protein of unknown function, D...		Lus10022171 [exp]	8.5	0.9514
AT1G63300			Myosin heavy chain-related pro...		Lus10008482 [exp]	8.8	0.9540

Compare expression of checked genes

Lus10031264 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.